당뇨병 환자에서의 PCR를 이용한 apolipoprotein E 유전자형 분석

팽정령 ( Jung Ryung Paeng ),김덕윤 ( Deog Yoon Kim ),우정택 ( Jung Taek Woo ),김성운 ( Sung Woon Kim ),양인명 ( In Myung Yang ),김진우 ( Jin Woo Kim ),김영설 ( Young Seol Kim ),김광원 ( Kwang Won Kim ),최영길 ( Yong Kil Choi ) 대한임상검사과학회 1992 대한임상검사과학회지(KJCLS) Vol.24 No.1

당뇨병은 고지혈증이 흔히 동반되며 다양한 벼인이 관여된다. Apolipoprotein E(단백질의 변이는) 고지혈증 유발성과 apo E isoform 의 분석이 시행되고있다. 최근 apo E 유전자형을 밝히는데 polymerase chain reaction(PCR) 방볍이 이용되고 있다. Apo E 는 299개의 아미노상으로 되어 있고 3개의 isoform 을 갖고 있는데 112번 158번째 아미노산서열의 차이점에 따라 E2, E3, E4로 구분한다. 본 연구에서는 apo E gene 을 PCR 법으로 증폭시켜 Hha I 제한효소로 소화시킨 다음 polyacryl-amide gel electrophoresis 하여 간편하고 신속하게 유전자형을 결정하였다. Hha I 은 Arginine 을 encod-ing 하는 GCGC sote를 인식 절단하는 효소이며 112arg(E4)과 158 arg(E3, E4)는 전단하지만 112cys(E2, E3) 와 15CYS(E2)는 GTGC 로 절단하지 못한다. 이러한 제한효소의 특성을 이용하여 Hha I restriciction fragment length 를 조사하였다. 당뇨병 환자 79명에서 각가의 유전자형을 분류한 결과 E2(6.3%), E3(81.0%), E4(12.7%)로 나타났으며 정신인 73명에서의 유전자형은 E2(4.8%), E3(84.9%), E4(10.3%)로 나타났다. 이상의 결과에서 보면 당뇨병 환자와 대조군과의 유전자 빈도에서의 통계적 유의성은 없었다. 그러나 유전자 빈도에 있어서는 우리 결과와 일본의 결과는 매우 유사하지만 유럽 지역의 결과와는 차이를 보였다. 이러한 결과의 차이는 인종간의 차이 및 유전자형을 결정한는 PCR법과 단백질을 분석하는 isoelectric focusing 간의 차이로 생각되며 향후 PCR법 이 유전자형을 결정하고 진단하는데 중요한 분야기 될 것으로 사료된다.

임신성 당뇨병 환자에서 글루코키나제 유전자의 췌도 B 세포 특이 프로모터 -30bp 부위의 변화

김진우(Jin Woo Kim),양인명(In Myung Yang),김성운(Sung Woon Kim),김영설(Young Seol Kim),최영길(Young Kil Choi),우정택(Jung Taek Woo),김세윤(Se Yoon Kim),오승준(Seung Joon Oh),팽정령(Jeon Ryung Paeng),장학철(Hak Chul Chang) 대한내과학회 1999 대한내과학회지 Vol.57 No.5

N/A Glucokinase is expressed only in both liver and pancreatic beta cells and has a key role in the regulation of glucose metabolism in these tissues. A number of gene defects associated with glucokinase gene and the cause of non-insulin-dependent diabetes mellitus are known, and the defects along the -30bp promoter site in particular are thought to be related to diabetes and glucose intolerance. To research on gene study related to diabetes, we looked into the relationship between the variation at -30bp of pancreatic beta cell specific glucokinase gene promoter and gestational diabetes mellitus(GDM) in Korea. Methods : Forty patients with GDM and 62 normal controls were studied. Genomic DNA was extracted from peripheral leukocyte of patients with GDM and normal controls. The nucleotide variation at -30 bp of pancreatic beta cell specific glucokinase gene promoter was analyzed by PCR-SSCP methods. The sequences of amplified DNA were confirmed with direct sequencing method. The clinical features and the response of insulin secretion to oral glucose were analyzed between patients with GDM according to genotypes. Results: Allelic frequency of position -30 bp of pancreatic beta cell specific glucokinase gene promoter did not differ between patients with GDM and normal subjects. However the frequency of G/A and A/A genotypes seemed to show a higher tendency in patients with GDM compare to the normal subjects. Clinical features, insulin response to oral glucose did not differ according to the type of variation at -30bp of pancreatic beta cell specific glucokinase gene promoter. Conclusion : These data suggested that the variation at -30 bp of pancreatic beta cell specific glucokinase gene promoter in patients with GDM are unlikely to be one of the possibilities of the genetic factors in the development of GDM. Therefore more sophisticated studies will be needed to elucidate the role of variation at -30bp of pancreatic beta cell specific glucokinase gene promoter in the insulin secretion to oral glucose. (Korean. J. Med 57:916-924, 1999)

고콜레스테롤혈증이 동반된 한국인 제2형 당뇨병 환자에서 심바스타틴의 지질개선 효과와 아포지방단백 E와 콜레스테롤에스테르 전달단백질의 유전자형에 따른 차이

고관표 ( Gwan Pyo Koh ),진현정 ( Hyoun Jung Chin ),전숙 ( Suk Chon ),오승준 ( Seung Joon Oh ),우정택 ( Jeong Taek Woo ),김성운 ( Sung Woon Kim ),김진우 ( Jin Woo Kim ),김영설 ( Young Seol Kim ),손호영 ( Ho Young Son ),이문규 ( Mo 한국지질동맥경화학회(구 한국지질학회) 2004 韓國脂質學會誌 Vol.14 No.2

한국인 인슐린 비의존성 당뇨병환자에서 미토콘드리아 유전자 3243 위치의 점돌연변이

이상경(Sang Kyeong Lee),송종훈(Jong Hoon Song),우정택(Jung Taek Woo),김성운(Sung Woon Kim),양인명(In Moon Yang),김진우(Jin Woo Kim),김영설(Young Seol Kim),최영길(Young Kil Choi) 대한내과학회 1996 대한내과학회지 Vol.51 No.3

N/A Objectives: It is well-known that inheritant factors contribute to the development of noninsulin-dependent diabetes(NIDDM). Several candidate genes, including genes for insulin, the insulin receptor, glucokinase and facilitative glucose transporters, have been examined for their involvement in the pathogenesis of NIDDM. Recently it is of interest to focus to relation of mutations in the mitochondrial gene and maternally inherited diabetes and deafness world wide. But in Korea, a few studies have been repirted about the mitochondrial gene mutation in patients with diabetes and so, as a first step of the study of mitchondrial DNA(mtDNA) mutation, we screened 500 NIDDM patients to know the prevalency of A to G transition at nucleotide pair 3243 of mitochondrial DNA tRNALeu(UUR) gene. Methods: Genomic DNA was extracted from the peripheral leukocytes of the patients who diagnosed as NIDDM during the period from march 1993 to december 1994. The mtDNA fragment surrounding the nucleotide pair 3243 site was amplified by polimerase chain reaction using sense primer 5'- AGGACAAGAGAAATAAGGCC(np 3130-3149) and antisense primer 5'-CACGTTGGGGTTCTTGCGTA (np 3404-3423). These fragments were digested with restriction endonuclease Apa I, and subjected to 1.5% agarose gel electrophoresis Results: No digested mtDNA band was found. In other words, Any A to G transition at np 3243 of the mitchondrial gene was not identified in 500 unrelated NIDDM patients screened. Conclusion: A subtype of diabetes mellitus associated with a mitochandrial tRNALeu(UUR) gene mutation seems to be very rare in Korea.

최근 10 년간 917 예의 요로결석 성분의 적외선 분광계 분석과 임상소견의 추이

오승준(Seung Joon Oh),강성이(Sung Yi Kang),홍승모(Seung Mo Hong),팽정령(Jung Ryung Paeng),우정택(Jung Taek Woo),양인명(Ihn Myung Yang),김성운(Sung Woon Kim),김진우(Jin Woo Kim),김영설(Young Seol Kim),김광원(Kwang Won Kim),최영길(Youn 대한내과학회 1995 대한내과학회지 Vol.48 No.1

N/A N/A

식사요법만으로 조절되지 않는 인슐린비의존형 당뇨병 환자에서 voglibose의 식후 혈당강하 효과에 대한 다기관 개방 연구

정재훈,민용기,김진우,이지현,송영득,김덕윤,최영길,김영설,김광원,이문규,이현철,양인명,우정택,김성운,이명식,차봉수,안규정,원형준 대한당뇨병학회 1998 Diabetes and Metabolism Journal Vol.22 No.3

뇌혈관질환을 동반한 당뇨병 환자에서 지속적 혈당측정의 유용성 평가

정성훈,강인구,박철영,류미숙,우정택,김성운,김진우,김영설 대한당뇨병학회 2002 임상당뇨병 Vol.3 No.2

연구배경: 뇌혈관질환을 동반한 고령의 당뇨병환자는 이들의 신경학적 결손으로 경고 증상없이 심한 저혈당에 노출될 가능성이 크다. 실제로 하루 4번 정도의 자가 혈당 측정으로는 이를 감지하기 어려울 뿐 아니라 검사에 따른 고통으로 적극적인 혈당 조절에 제한이 따르게 된다. 이에 저자들은 Mini Med사의 지속적 혈당측정기(CGMS, continuous glucose monitoring system)를 이용하여 뇌혈관질환을 동반한 당뇨병 환자에서 24시간 혈당의 변동양상을 알아보고 각기 다른 인슐린 치료방침에 따른 혈당조절의 효율성을 비교하고자 하였다. 방법: 2001년 1월부터 6월까지 경희대학교 부속병원에 입원해 있는 10명의 뇌혈관질환을 동반한 제 2형 당뇨병환자를 대상으로 하였다. 이 들은 모두 튜브식이를 받고 있엇고 최소 1개월 이상 인슐린 치료를 시행 받았다. 지속적 혈당측정기를 착용하고 3일간의 연속적인 혈당을 측정하였고, 치료 첫 날은 NPH, 둘째 날은 속효성 인슐린과 NPH, 마지막 날은 혼합형 인슐린제제로 치료하여 그 효과를 비교하였다. 이들 각기 다른 인슐린 제재의 하루 총량에 차이는 없었다. 혈당치가 3.3mmol/L 미만이거나 7.8mmol/L를 초과하는 경우 그 차이값의 총합을 시간으로 나누어 이 값(△Glu)이 적을수록 치료효과가 우수한 것으로 판정하였다. 또한 당 수치가 3.3mmol/L 미만인 경우를 저혈당 event, 16.7mmol/L 초과한 경우를 고혈당 event로 임의로 정의하였고, 이를 통해 지속적 혈당측정의 유용성을 간접적으로 평가하고자 하였다. 결과: 평균 △Glu값은 첫째 날이 0.93 ± 0.43mmol/Lㆍmin?¹, 둘째날이 0.71 ± 0.29mmol/Lㆍmin?¹ 마지막 날이 0.58 ± 0.29mmol/Lㆍmin?¹로서 서로 다른 3가지 치료방침사이에 통계학적으로 유의한 차이는 없었다(p=0.115). 10명의 환자들 중 자가 혈당측정기로는 1명에서 저혈당 event, 2명에서 고혈당 event를 인지하였으나 지속적 혈당측정기로는 각각 9명에서 event를 확인하였다. 결론: 지속적 혈당측정기를 이용한 각각의 인슐린 치료방침에 따른 혈당조절 효율성의 차이는 없었으나, 자가혈당 측정기로는 알 수 없었던 일 중 혈당 변동사항을 정확하게 알 수 있어, 뇌혈관질환을 동반한 당뇨병 환자에서 보다 적극적인 인슐린 치료 및 관리를 할 수 있을 것으로 생각된다. Background: Diabetic stroke patients are susceptible to hypoglycemia. However, there are many limitations in detecting hypoglycemic events, even though glucoses levels are checked 3 to 4 times per day using the fingerstick method. Therefore, we investigated the glycemic excursions and pattern in diabetic stroke patients using the continuous glucose monitoring system (CGMS, MiniMed) and its clinical utility. The other objective was to compare the treatment dfficacy between insulin regimens. Methods: From jan 2001 to jun 2001, 10 adult type 2 diabetic stroke patients wore CGMS for consecutive 3 days, which continuously checked the glucose level. NPH insulin, multiple daily injection of regular insulin ± NPH and the mixed type(Novolet 30/70, Novo Nordisk) were used on the first, second and third days of the study, respectively. If the mean delta glucose(△Glu = A+B/time, A=∑(hlucose-7.8), glucose > 7.8 mmol/l, B=∑(3.3-glucose) if, glucose < 3.3 mmol/l) was calculated in order to recognize the degree of individual glycemic changes and to compare the efficacy of each treatment diverse insulin regimen. We arbitrarily defined a glucose level less than 3.3mmol/l, as a hypoglycemic event, and more than 16.7mmol/l as a hyperglycemic event. Results: Variable patterns of glycemic changes were observed among patients with the same dosage, but a different insulin regimen. The mean △Glu was 0.93±0.43 on the first day, 0.71±0.29 on the second day and 0.58±0.29 on the third. There was no significant difference in treatment efficacy between the 3 different insulin modalities(p=0.115). Of the 10 patients, a hypoglycemic event was detected in 1 with the fingerstick method, in contrast to 9 with CGMS, with hyperglycemic events being detedted in 2 and 9, respectively. Conclusion: Continuous glucose monitoring maybe useful in providing the information necessary for optimal glycemic control in the diabetic stroke patients.

Agranulocytosis에서의 골수세포<CFU-GM> 생체외 배양 1예

우정택,손영진,김성민,오정균,윤휘중,조경삼 大韓血液學會 1985 大韓血液學會誌 Vol.20 No.1

쥐의 갑상선 자극 호르몬-방출호르몬 유전자의 당질코르티코이드 반응요소(Glucocorticoid Response Element, GRE)의 특성

정운원,최영길,양인명,우정택,김성운,김진우,김영설,최영길 경희대학교 생명자원과학연구원 1998 遺傳工學論文集 Vol.10 No.-

배경 및 목적 :갑상선자극인자-방출호르몬(Thyro-tropin-releasing hormone, TRH)의 분비 및 유전자 발현은 당질코르티코이드에 의하여 촉진되거나 억제되는데, 이러한 반응은 조직에 따라 다르다. 조직 특이성의 기전을 규명하기 위해서는 우선 TRH 유전자의 당질코르티코이드 반응요소(glucocorticoid response element, CRE)의 위치와 특성을 규명되어야 한다. 최근 본 연구자등은 TRH 유전자의 촉진자 위 -200 bp와 -220 bp 사이에 GRE가 존재하는데, -200 bp와 -205 bp 사이에 GRE 공감서열의 half site인 TGTTCT가 있고 그 양 옆으로 TPA 반응요소(TPA response element, TRE)와 유사한 서열 TACTCA가 연결되어 있는 특이한 구조를 가지고 있음을 보고하였다. 본 연구는 이 CRE/TRE 복합서열이 당질코르티코이드와 TPA에 반응을 하고, 전사인자인 당질코르티코이드 수용체(glucocoiticoid receptor, GR)와 c-Jun이 결합을 하는지 여부를 조사하기 위하여 수행되었다. 방법 : 배양된 HeLa 세포에 CRE/TRE 복합서열을 포함하고 있는 TRH 유전자의 촉진자를 luciferase 유전자 앞에 연결시킨 플라즈미드를 Fugene 6를 이용하여 주입한 후, 덱사메타손(DEX)과 TPA(12-O-tetradecanoyl phobol-13-acetate)로 자극하고 세포를 파괴시켜luciferase 활성을 측정하였다. GRE와 TRE의 염기서열 일부를 다른 뉴클레오타이드로 치환한 여러 가지 돌연변이를 제작하여 동일한 방법으로 실험하여 야생형의 전사활성 정도와 비교하였다. 그리고, GR과 c-Jun을 GRE/TRE 복합서열과 결합시킨 후 겔지연분석을 시행하였다. 연구결과 : DEX와 TPA는 야생형의 전사활성을 각각 2.5배, 4배 증가시켰고, 동시에 두 가지로 자극하였을 때는 10배 증가시켰다. GRE의 두 가지 돌연변이들은 DEX에 전혀 반응을 보이지 않았으며, TPA에 대한 반응도 야생형의 50% 정도로 저하되었다. TRE의 3'쪽 돌연변이와 5'쪽 돌연변이의 DEX에 대한 반응과 TPA에 대한 반응은 각각 야생형의 20%, 25%이었으나, 양쪽 돌연변이의 반응은 야생형과 유사하였다. 겔지연분석상 GR과 CRE/TRE 복합서열에 의한 합체는 한 개의 띠로 보였으며, GRE 돌연변이는 야생형에 비하여 GR과의 결합 친화도가 현저히 낮았다. c-Jun에 의한 복합체는 두 개의 띠로 보였는데, 복합서열의 결합 친화도는 TRE 공감서열에 비하여 현저히 낮았다. 3'과 5' TRE 돌연변이들도 야생형에 비하여 c-Jun과의 결합 친화도가 현저히 낮았으나, 양쪽 돌연변이의 친화도는 야생형의 친화도와 유사하였다. GR과 c-Jun을 동시에 결합시켰을 경우와 두 단백이 결합된 분자량이 큰 복합체는 관찰되지 않았으며, GR에 의한 복합체는 c-Jun에 의한 복합체보다 분자량이 현저히 작아 단일체로 결합되었을 것을 암시하였다. 결론 : 쥐 TRH 유전자의 전사조절 부위에 존재하는 GRE/TRE 복합서열은 GR과 c-Jun이 결합하여 상호작용을 할 수 있는 장소를 제공하여 줌으로써 HeLa 세포에서는 당질코르티코이드와 TPA가 전사 활성을 상승적으로 촉진할 수 있다. 향후 당질코르티코이드에 의하여 TRH 유전자의 전사가 억제되는 세포에서는 이 복합서열에서 GR과 다른 전사인자들이 어떻게 상호작용하여 전사를 억제하는지 연구가 필요할 것으로 사료된다. We previously demonstrated that the promoter of rat TRH gene has GRE half site (TGTTCT) between-210 bp and-205 bp flanking with similar sequences of TPA response element (TRE). TAGTCA, at a distance of several base pairs from the GRE half site. It prompt us to hypothesize that this composite GRE/TRE sequence can provide a site for interaction between glucocorticoid receptor (GR) and c-Jun. Thus, we investigated whether the composite sequence mediates transcriptional regulation induced by dexamethasone (DEX) and 12-O-tetradecanoyl phobol-13-acetate (TPA), and it binds GR and c-Jun. The Luciferase expressing plasmids that contain a part of rat TRH promoter including the composite sequence or its mutants were transfected into HeLa cells by Fugene 6. After the cells were incubated overnight with DEX and TPA, the luciferase activity was measured in a chemiluminometer. A gel retardation assay was performed after binding of the labeled composite sequence or its mutants with GR and c-Jun. DEX increased the transcriptional activity of the plasmid containing the wild type GRE by 2.5 folds, and TPA increased the transcriptional activity by 4 folds. The simultaneous stimulation with DEX and TPA synergistically increased the transcriptional activity by 10 folds. Two mutants whose GRE half site was altered showed no response to DEX. and suppressed the TPA-induced or both agents-induced transcriptional activity by 50%. Two mutants whose TRE-like site was altered suppressed the DEX-induced transcriptional activity by 20%, TPA-induced transcriptional activity by 25%. and both agents-induced transcriptional activity by 50%. Gel retardation assay showed that the composite sequence formed a complex with GR and its mutants bound to GR with a remarkably less affinity, c-Jun also bound to the composite sequence to form two complexes with a less affinity compared to the AP-1 consensus sequence. The mutants of the TRE-like sequence bound to c-Jun with a significantly lower affinity compared to that of the wild type. Simulateous binding of the composite sequence with GR and c-Jun did not form any larger complex. The complex of GR and the composite sequence was much smaller than that formed by c-Jun, suggesting that GR binds to the composite sequence as a monomer. These result suggest that the composite sequence of GRE half site and TRE-like site on the promoter of rat TRH gene provides binding sites for GR and c-Jun, which mediate the interaction between two signal transduction pathways.

인슐린 비의존형 당뇨병 및 비만증 환자에서의 PPARγ2 유전자 다형성

김진우,우정택,김덕윤,최영길,김영설,양인명,김성운,오승준,강성이,박혜순,팽정령 대한내과학회 2000 대한내과학회지 Vol.59 No.2

Background : Peroxisome proliferator activated receptor-gamma (PPAR-γ) is a nuclear receptor that regulate adipocyte differentiation and modulate intracellular insulin-signaling events. As such, PPARγ is a candidate gene for several human disorders including obesity and type 2 diabetes mellitus. The objective of our study was to examine the relationship between genetic variation of PPARγ2 and diabetes and obesity in Korean subjects. Methods : We studied 99 subjects with type 2 diabetes mellitus, 128 obesity patients and 97 controls. Screening for mutation at codon 12 and 115 of PPARγ2 were carried out by PCR-RFLP analyses. Statistical significance was evaluated by Chi-square test. Results : The allele frequency of the Pro12Ala PPARγ2 variant were 0.05 in controls, 0.06 in type 2 diabetes group, and 0.07 in obesity group (p=0.47). Pro115Gln variant were only proline homozygote in all groups. Genotype frequencies were also similar and conformed to expectations of the Hardy-Weinberg rule. The presence of P gene variant was no associated with concentrations of total cholesterol, triglyceride, HDL-cholesterol, and also with fasting glucose. Conclusion : We concluded that the Pro12Ala and Pro115Gln PPARγ2 missense mutation may not be associated with type 2 diabetes mellitus and obesity in Korean patients.(Korean J Med 59:132-141, 2000)