http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
임재영,신동호,Im, Jae-Yeong,Sin, Dong-Ho 충남발전연구원 2006 열린충남 Vol.34 No.-
임재영.신동호 박사는 행정중심복합도시 개발의 파급효과를 생산효과, 부가가치효과, 고용효과의 측면에서 분석하였으며, 행정중심복합도시가 국가균형발전을 도모할 수 있는 핵심대안이라고 주장하였다. 발표논문의 주요 내용을 요약하여 전재한다.
적혈구 이형성증(Dyserythropoiesis)의 소견을 보이는 부분 21-monosomy 증후군
임재영,서지현,최명범,박찬후,우향옥,윤희상,Lim, Jae-Young,Seo, Ji-Hyoun,Choi, Myoung-Bum,Park, Chan-Hoo,Woo, Hyang-Ok,Youn, Hee-Shang 대한소아청소년과학회 2003 Clinical and Experimental Pediatrics (CEP) Vol.46 No.4
저자들은 특이한 얼굴, 근 긴장도 증가, 정신 지체와 혈액학적으로 일시적인 적혈구 이형성증(dyserythropoiesis)의 소견을 동반한 MDS 의증의 소견과 혈소판 감소증, 호산구 증가증을 동반하는 부분 21-monosomy 증후군 1례를 신생아기부터 8세까지 추적 관찰하고 보고한다. 이와 같은 예는 우리나라에서 보고되는 첫 증례라고 사료되어 간단한 문헌 고찰과 함께 보고하는 바이다. All complete monosomy 21 appear to be lethal early in their development in humans and only survive in mosaic forms. Complete monosomy 21 is a very rare and usually debilitating genetic disorder. Partial monosomy 21 is also rare and is thought to constitute a clinical syndrome consisting of peculiar faces, hypertonia, psychomotor retardation, and slow growth. We experienced a case of monosomy 21 mosaicism. Chromosome analysis demonstrated mosaicism for cell lines in the lymphocytes examined; 45, XX, -21/46, XX. The main clinical features were craniofacial dysmorphism including high arched palate, submucosal cleft, micrognathia and arthrogryposis-like symptoms including flexion deformity of fingers. And hematological findings were revealed dyserythropoiesis, thrombocytopenia and eosinophilia. Currently, the patient has nearly compatible growth, but a mild degree of mental retardation. We report here an 8 years old female child with apparent monosomy 21 mosaicism associated with dyserythropoiesis, thrombocytopenia and eosinophilia, with a review of the associated literatures.
영아에서 Helicobacter pylori 감염에 대한 항체반응
임재영,고경혁,조명제,김은아,김윤옥,윤희상,백승철,이우곤,이광호,우향옥,박찬후,정양숙 대한소화기학회 2000 대한소화기학회지 Vol.35 No.6
Background/Aims: The early stage of Helicobacter pylori (H. pylori) infection may show only anti-H. pylori IgM antibody response in young infants. We tried to find out the antigens of H. pylori which stimulate antibody response during the early stage of infection using IgM, IgA, and IgG immunoblot analyses. Methods: Sera of 48 infants were collected at birth and 7 months of age under the permission of parents and sera of 17 infants were also collected at 3 months and 9 months after birth. For those sera, IgM, IgA, and IgG immunoblotting were performed. Results: At the first study, seventeen of 48 (35.4%) infants show 120 kDa band on IgM or IgA immunoblot at 7 months of age. Four infants showed 120 kDa band on IgM immunoblot but not on IgA immunoblot. They were assumed to be infected very recently. At the second study, 2 of 17 showed strong IgM immune response to H. pylori at 3 months of age. The 120, 61, 60, 56, 54, 35, 29, 25, 18 kDa bands were recognized on IgM immunoblot in both studies. Conclusions: At 7 months of age, 35.4 % of infants were infected with H. pylori. Antigens of H. pylori which stimulate antibody response during the early stage of human infection were 120, 61, 60, 56, 54, 47, 29, 25, 18 kDa.
연령과 성별이 한국 노인의 신체 기능과 삶의 질에 미치는 영향
임재영,김병희,박준혁,이석범,백남종,김기웅 대한재활의학회 2007 Annals of Rehabilitation Medicine Vol.31 No.4
Objective: To investigate the physical function of Korean elderly by age and gender and to assess the impact of declined physical function on their quality of life. Method: The Korean Longitudinal Study on Health and Aging (KLoSHA) is designed as a populationbased prospective cohort study on health and aging of Korean elderly aged 65 years and over. In one city among the central metropolitan area for one year, 1,000 subjects includeing a simple random sample and an oldest-old subpopulation participated in baseline study. All subjects are older than 65 years (76.3±14.8, 65∼98 years). We surveyed their general characteristics and symptoms related physical function and examined physical function, functional disabilities, balance function and quality of life with standardized assessment tools. Results: The strengths of quadriceps were preserved over the functional level, but BMI was significantly reduced according to age irrespective of sex. Physical function and quality of life were consistently decreased according to age in female elderly, especially over 80 years. On the contrary, male elderly under 85 years preserved their physical function. In 85∼89 year group, they showed the remarkable disabilities related to musculoskeletal conditions or pain and decrease of balance. Elderly people had greater disabilities and lesser confidence for balance, lower quality of life irrespective of sex. Conclusion:Significant gender differences in Korean elderly were found in the patterns of functional decline. Physical dysfunctions and disabilities are main factors lowering quality of life.
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
불평등과 행복: Sen의 역량이론의 관점에서 본 불평등의 작동 메커니즘
임재영,구교준,최슬기 서울대학교 한국행정연구소 2016 行政論叢 Vol.54 No.3
Recent studies have considered inequality as one of the most important determinants of happiness. This study examines the mediating effects of inequality on happiness based on the capability perspective introduced by Armatya Sen. Capability is defined as “what people are able to do or to be,” which can be well-aligned with inequality. The results show that as the level of inequality increases, income plays a more important role as a determinant of happiness. On the other hand, income slowly loses its importance as a determinant of happiness as the level of social mobility increases. These results imply that sustainable improvement of overall psychological well-being demands policy efforts to reduce inequality in a society. 많은 기존 연구들이 불평등을 행복의 중요한 결정요인으로 다루고 있다. 그러나 어떤 메커니즘을 통해 불평등이 행복에 영향을 끼치는지에 대한 논의는 충분히 이루어지지 않고 있다. 본 연구는 소득의 한계효과에 영향을 미치는 조절변수로서 불평등의 작동 메커니즘에 대한 설명을 Sen의 역량이론과 연결시켜 시도한다. Sen의 역량 개념을 개인이 가치를 두고 있는 행위나 상태를 얼마나 자유롭게 추구하고 달성할 수 있는지라고 정의한다면, 계층 이동이 어려운 구조적 불평등은 바로 역량이론에서 강조하는 개인이 각자의 가치를 자유롭게 추구할 수 있는 환경이 결여되어 있음을 의미한다고 볼 수 있기 때문이다. 분석결과에 따르면 우선 한 사회의 불평등 정도가 높아질수록 소득의 중요성이 커지는 현상이 관찰되었다. 또한 개인의 계층 이동 가능성이 높이 평가되는 평등한 사회일수록 행복 결정요인으로서 소득의 중요성이 줄어드는 현상이 관찰되었다. 본 연구의 결과는 정책적인 측면에서 매우 중요한 함의를 가진다. 역량 중심의 접근은 소득과 같은 삶의 상대적 조건의 영향을 감소시켜 보다 지속가능한 행복이 가능하게 해 준다. 불평등이 삶의 역량 수준을 보여주는 좋은 지표라고 한다면, 개인 간, 계층 간 불평등의 해소를 위한 정책적 노력이 사회 전반적으로 지속가능한 행복 수준의 제고로 이어질 수 있을 것이다.
임재영,조창익 한국개발연구원 2011 KDI Journal of Economic Policy (KDI JEP) Vol.33 No.1
Although the patient’s problem with access to health information has been improved due to rapidly developing information technologies, such as the internet, some patients still do not have enough ability to understand, interpret, and analyze the health information. Given this view on the patient’s asymmetric information problem, if a doctor provides sufficient effort to help patients understand and interpret medical information, the efficiency of patient’s medical care use could be improved. This paper shows firstly that the patient’s inefficient use of medical care originates from his information problems, such as the misperception of the effectiveness of medical care and secondly suggests that if the doctor makes sufficient effort to correct patient’s information problems, the inefficiency can be ameliorated. This paper also suggests the manipulation of a doctor’s payment method can lead a doctor to provide optimal level of efforts which can in turn lead patients to use the optimal level of medical care. With an optimal level of effort, a doctor can more easily achieve a patient’s compliance with the newly recommended amount of medical care.
임재영 한국개발연구원 2011 KDI Journal of Economic Policy (KDI JEP) Vol.33 No.1
This paper demonstrates empirically that individuals who monitor indicators of their current cardiovascular health status by undergoing medical examinations are more likely to invest in their own health than those who do not observe such monitoring protocols. Using data from the 2001 National Health and Nutrition Examination Survey of Korea in a structural econometric model, this paper attempts to control the endogeneity problem inherent to the individual decision as to whether to undergo medical examinations, and provides estimation results showing that increased individual health awareness via medical examinations exerts a statistically significant positive effect on health investments. From the policy perspective, the estimation results of this paper may provide a rationale supporting the health policy of free provision of health examination services to the insured via National Health Insurance.