http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
박히준,채윤병,차웅석,박종배,이혜정,이향숙,인창식,고형균,김수영,최일환,김강식,문정배,배기태,유경환,육근영,정병주,손인철,임사비나 WHO COLLABORATING CENTRE FOR TRADITIONAL MEDICINE 2004 東西醫學硏究所 論文集 Vol.2004 No.-
Background : The cun measurement System, an essential and convenient method in locating acupoints, has been widely used in the practice of acupuncture. However, traditional cun measurement has been criticized for its lack of reliability. Objectives : The purposes of this study are to determine if one cun measured by the directional methods have a consistency with that of proportional methods and to investigate which factors are related with these differences, especially in forearm. Methods : The distance between the elbow crease and the wrist crease of forearm was compared to a reference value of one cun obtained by the directional method. In this method, one cun is one third of the distance between index finger and Small finger of a subject, measured at proximal interphalangeal joint. In addition, to investigate the factors influencing the differences between these two methods, we measured the height and body weight and calculated body mass index (BMI). Finally we analyzed the factors correlated with these lengths by linear regression test. Results : The results showed that one cun obtained by the directional methods were significantly different from one cun by the proportional methods in forearm. It was demonstrated that the length acquired with the directional method was more correlated with body weight and body mass index, while the length obtained by the proportional method was more correlated with the height.
Factors Associated with Removal of Impactted Fishbone in Children, Suspected Ingestion
Lim, Chun Woo,Park, Min Hwan,Do, Hyun Jeong,Yeom, Jung-Sook,Park, Ji Sook,Park, Eun Sil,Seo, Ji Hyun,Park, Jung Je,Lim, Jae Young,Park, Chan Hoo,Woo, Hyang-Ok,Youn, Hee-Shang The Korean Society of Pediatric Gastroenterology 2016 Pediatric gastroenterology, hepatology & nutrition Vol.19 No.3
Purpose: The management and clinical course in pediatric patients who had ingested foreign body were investigated retrospectively to evaluate the frequency and factor associated with successful removal of fishbone foreign body. Methods: Based on the medical records of patients younger than 15 years old who visited emergency room because of foreign body ingestion from January 1999 to December 2012, the authors reviewed clinical characteristics including type of ingested foreign bodies, time to visits, managements and complications. Results: Fishbone (50.1%) was the most common ingested foreign body in children. Among 416 patients with ingested fishbone, 245 (58.9%) were identified and removed using laryngoscope, rigid or flexible endoscope from pharynx or upper esophagus by otolaryngologists and pediatric gastroenterologists. The kind of ingested fish bone in children was diverse. The mean age of identified and removed fishbone group was 7.39 years old, and higher than that of unidentified fishbone group (5.81 years old, p<0.001). Identified and removed fishbone group had shorter time until hospital visit than the unidentified fishbone group (2.03 vs. 6.47 hours, p<0.001). No complication due to ingested fishbone or procedure occurred. Conclusion: Older age and shorter time from accident to hospital visit were the different factors between success and failure on removal of ingested fish bone in children.
공격적 유아를 위한 애착증진 집단치료놀이 프로그램 개발과 적용
이향숙 ( Hyang Sook Lee ),임지향 ( Ji Hyang Lim ),권명옥 ( Myung Ok Kwon ) 한국정서.행동장애아교육학회(구.한국정서학습장애아교육학회) 2006 정서ㆍ행동장애연구 Vol.22 No.1
본 연구에서는 자아존중감 증진을 공격성감소의 주요요인으로 본 애착이론에 근거하여 공격적 유아를 대상으로 애착증진 집단치료놀이 프로그램을 개발 적용한 연구이다. 집단치료놀이 프로그램은 초기, 중기, 종결단계로 나누어지고 회기별 목적에 따라 7단계 총 20회기로 구성되었다. 연구대상은 유치원에 신입한 만3, 4, 5세 유아 총 143명을 대상으로 부모용 유아공격성 검사와 교사용 유아공격성 검사를 실시하여, 검사 모두에서 척도 중립점수 이상을 받은 유아들 중에서, 10명의 원아에게 주2회, 30분씩 10주간 총 20회기의 집단치료놀이를 실시하였다. 프로그램의 효과를 검증하기 위해 치료 전회기 녹화된 비디오테이프의 전사한 내용에서 회기별 변화를 공격행동, 과제집중, 활동방해·거부, 미소·웃음의 행동표본을 토대로 회기별 행동변화 추이분석 한 결과, 공격행동과 활동방해·거부가 감소된 반면, 과제집중과 미소·웃음은 증가되었다. 이러한 치료효과는 일상생활 속에서 유아의 문제행동이 많이 감소되고 자신감이 생겼으며, 다른 사람의 감정을 고려하는 행동을 보인다고 언급한 치료적용 후 부모·교사의 면담을 통해서도 알 수 있었다. The purpose of this study is to develop and apply the Group Theraplay program to enhance the attachment of the infant who have some trouble with social competence in connection with child aggression, and this study is based on attachment theory which refers reduction of aggression to self esteem. The group Theraplay program is divided into the beginning, middle and closing, which are comprised of the seven steps with total twenty sessions depending on the purpose of each session. Total 143 three, four or five year old infants are the objects of this study who just have entered into preschool. Infant aggression tests for both parents and teachers have been taken for these infants. Among them, ten infants who got above the average scores in all test measures have then participated in thirty-minute group Theraplay program, twice a week for ten weeks. To verify the effects of the program, the analysis have been carried out based on the samples of aggressive behavior, task concentration, rejection of activity interference and smile/laugh from the contents of video tape recording. As an analysis result, child aggression, activity interference and rejection were reduced. In the mean time, task concentration and smile·laugh activities were enhanced. Such result was shown through the analysis of behavior change progress by each term of the group theraplay. Furthermore, through interview with the parents and teachers after applying the group theraplay, I confirmed the effects that the infants were greatly reduced in behavior problems, obtained self-confidence and behaved in consideration of other`s emotions.
Jeong, Hoar Lim,Jung, Yang-Sook,Jun, Jin-Su,Yeom, Jung Sook,Park, Ji Sook,Seo, Ji-Hyun,Lim, Jae-Young,Park, Chan-Hoo,Woo, Hyang-Ok,Youn, Hee-Shang,Ko, Gyung-Hyuck,Baik, Seung-Chul,Lee, Woo-Kon,Cho, My The Korean Society of Pediatric Gastroenterology 2012 Pediatric gastroenterology, hepatology & nutrition Vol.15 No.2
Purpose: Commercial enzyme-linked immunosorbent assay (ELISA) kits have been considered less reliable for children than for adults. The aim of this study was to compare four ELISA kits and in-house immunoblotting based on the analysis of anti-H. pylori-IgG antibody reactivity. Methods: A total of 399 serum samples were collected at the GNU Hospital during 1998-1999. All sera were tested using ELISA and immunoblotting. Statistically significant differences were determined by the $x^2$ test. Results: The overall seropositivity rates using GAP IgG, Genedia IgG, HM-CAP, Pyloriset EIA-G, and immunoblotting were 13.0%, 25.1%, 18.3%, 15.8%, and 62.9%, respectively. Immunoblotting showed a higher seropositivity rate than did all four ELISA kits in all age groups. Genedia IgG had the highest seropositivity among the ELISA kits. The seropositivity rate for children aged 13 to 18 months was lowest, and that of children aged 15 years was highest (90.0%). The seropositivity rate for children aged 7 months to 5 years was significantly lower than that for children aged 6 to 15 years among the four ELISA kits (p<0.0001) and immunoblotting (p=0.02). Conclusion: Immunoblotting is the most sensitive test for detection of anti-Helicobacter pylori IgG antibodies among the serological tests in this study. These results emphasize the need for standardization when commercial ELISA tests are used in different nations or in young age groups. Immunoblotting could be a suitable noninvasive assay for serodiagnosis and seroepidemiologic study of H. pylori infection in Korean children.
레지오 에밀리아 접근법(Reggio Emilia Approach)이 유아의 창의력 증진에 미치는 효과
임상도,성숙향 이화여자대학교 사범대학 교육과학연구소 2004 교육과학연구 Vol.35 No.1
본 연구는 레지오 에밀리아 접근법이 유치원 아동의 창의력에 미치는 효과에 대해 알아보고자 하는데 그 목적이 있다. D시에 소재하고 있는 유치원들 가운데 임의로 선정된 2개의 유치원 원아 26명을 무선 표집하여 레지오 에밀리아 교육프로그램을 실시하는 유치원을 실험집단으로 단원중심교육프로그램을 실시하는 유치원을 통제집단으로 선정하여 사전검사-실험처치-사후검사로 진행하였다. 실험처치의 효과를 검증하기 위하여 검사도구는 전경원(2001) ‘유아 도형 창의성 검사’를 사용하였으며, 점수 처리는 서봉 유아 창의력 연구소에 의뢰하였다. SPSS/win을 이용하여 자료를 분석하였으며, 집단별로 사전검사 점수와 사후 검사 점수에 대해 2×(2) 반복 측정식 변량 분석을 하였다.레지오 에밀리아 접근법이 유아의 창의력과 하위구성요인인 유창성, 독창성, 개방성, 민감성에 미치는 영향을 알아본 결과를 바탕으로 얻은 결론은 다음과 같다. 첫째, 레지오 에밀리아 접근법 교육 프로그램인 실험집단이 단원중심교육프로그램인 통제집단보다 창의력 검사에서 높은 점수를 보였다. 둘째, 실험집단은 통제집단보다 유창성 검사에서 높은 점수를 보였다. 셋째. 실험집단은 통제집단보다 독창성 검사에서 높은 점수를 보였다. 넷째. 실험집단과 통제집단은 개방성 검사에서 차이를 나타내지 않았다. 다섯째, 실험집단과 통제집단은 민감성 검사에서 차이를 나타내지 않았다. 요약하면, 레지오 에밀리아 접근법이 유아들의 창의력 증진에 긍정적인 효과를 보였다. The purpose of this study is to identify the effects of Reggio Emilia Approach on the creativity of preschool children. The subjects were 26 children sampled randomly from two kindergartens in D city. 13 children were assigned to experimental group receiving Reggio Emilia Approach and other 13 children were assigned to control group receiving conventional unit-centered program. The experimental design was pre-post conrol experimental design. The session of the experiment was conducted for 8 weeks in April and May 2003. To test the effects of the intervention, Jun, Kyung-won(1977)'s 'Korean Figural Creativity Test for Young Children' was used. Scoring was referred to So-bong Creativity Institute. The data was analyzed by SPSS/win. The conclusions from this study were as follows: First, Reggio Emilia Approach significantly contributed to the creativity improvement. Second, Reggio Emilia Approach significantly contributed to the flexibility improvement of creativity. Third, Reggio Emilia Approach significantly contributed to the originality improvement of creativity. Fourth, Reggio Emilia Approach didn't contributed to the openness and sensitivity improvement of creativity. Generally, Reggio Emilia Approach contributed to the creativity improvement and discriminatingly contributed to the component of creativity according to the contents of the program.
Lim Jeong-A,이나리,Chun Hyang-Sook,장현주 한국응용생명화학회 2020 Journal of Applied Biological Chemistry (J. Appl. Vol.63 No.4
The antimicrobial resistance of food-borne pathogenic bacteria, including Vibrio parahaemolyticus, has been reported globally, warranting the need to identify promising alternative antibiotics such as endolysins that originate from bacteriophages. In our previous study, we characterized a bacteriophage infecting V. parahaemolyticus, vB_VpaP_KF2, at the molecular level. In this study, an open reading frame encoding putative endolysin was cloned from the complete genome data and expressed in the Escherichia coli expression system. The recombinant endolysin, vB_VpaP_KF2_Lys, exhibited a novel lytic property against Gram-negative bacteria regardless of pretreatment with an outer-membrane permeabilizer. It was also stable over a wide range of temperatures, pH, and NaCl concentrations, and its hydrolytic spectrum was broader than that of the parent bacteriophage. From the results, vB_VpaP_KF2_Lys could be used as a biocontrol agent against food-borne pathogens in the field of food safety.
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
지주막하강 및 뇌막에 미만성으로 전이된 수아세포종 1 예
임인숙,고일향,지제근 인제대학교 1984 仁濟醫學 Vol.5 No.4
Medulloblastoma, a highly malignant tumor of the cerebellum, accounts for 20 percent of the intracranial neoplasms in the pediatric age group with a 2:1 male preponderance and a peak frequency between 3 and 8 years of age. The tumor is believed to be derived from the medulloblast, an embryonal, bipotential cell, capable of maturation along either glial or neuronal cell lines. While medulloblastomas are known to occasionally spread along the CSF pathways, metastasis of this tumor outside of the CNS is considered rarely. Progressive head enlargement and hydrocephalus were the commonest modes of prerentation. The present report is on a case of medulloblastoma with diffuse subarachnoid and meningeal spread presenting with hydrocephalus. At autopsy, a well circumscribed, gray-white, soft, tumor mass, measuring 5.5×4.5cm in size, presents in the cerebellar vermis and 4th ventricle. Microscopically the tumor is highly cellular and is composed of small dark cells without any organoid patterns. The invidual tumor cells show round to ovoid, hyperchromatic nuclei and indistinct scanty cytoplasms. Occasionally pseudorosette and microcyst formation are noted and memerous mitotic figures are observed. The tumor is extending to the subarachnoid space and central canal of the spinal cord.