http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
폴리비닐클로라이드 해양광생물반응기와 고밀도 폴리에틸렌 해양광생물반응기에서 미세조류, Tetraselmis sp. KCTC12236BP의 생산성 비교
정성균(Seung-Gyun Jung),김수권(Su-Kwon Kim),변문섭(Moon-Sup Bun),조용희(Yonghee Cho),신동우(Dong-Woo Shin),김지훈(Z-Hun Kim),임상민(Sang-Min Lim),이철균(Choul-Gyun Lee) 한국해양바이오학회 2016 한국해양바이오학회지 Vol.8 No.1
It is important to design photobioreactor by cheap material for economical microalgal biomass production. In this study, two types of marine photobioreactors (MPBR), made by either polyvinyl chloride (MPBR-PVC) or high density poly ethylene (MPBR-HDPE), are used and performance of these were compared. Tetraselmis sp. KCTC 12236BP is a green marine alga that isolated from Ganghwa Island, Korea, and the strain was used for marine cultivations using MPBR-PVC and MPBR-HDPE. The cultivations were performed three times in the spring season of 2012 using MPBR-PVC and of 2013 using MPBR-HDPE in the coastal area of Young Heung Island. As the results, MPBR-PVC shows higher biomass productivities than MPBR-HDPE, due to its high light transmittance. In the cultivations using MPBR-PVC, the average sea water temperature was 11.5°C during the first experiment and 16.5°C during the second and third experiments. Average light intensities during three times for experiments were 407.5, 268.1 and 273.0 μ·E·m<SUP>-2</SUP>·s<SUP>-1</SUP>, respectively. The maximum fresh cell weight and average biomass productivity were 1.2 g·L<SUP>-1</SUP> and 0.12 g·L<SUP>-1</SUP>·day<SUP>-1</SUP>. These results showed that Tetraselmis sp. KCTC12236BP were adapted well with the environmental conditions from ocean, and grow in the MPBR-PVC and MPBR-HDPE.
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
임태균,이승규,이성주,김영근,최광성 대한피부과학회 2001 대한피부과학회지 Vol.39 No.9
Sneddon's syndrome is infrequem neurocutaneous disorder of unknown origin It is characterized by the combination of livedo reticularis and cerebrovascular accident We present a 57-year-old male patient with livedo reticularis and cerebrovascular accident. Magnetic resonance imaging of the head showed a sign of acute focal infarctions in the right cerebellar hemisphere and right vermis. He had netlike patterned, mottled bluish discoloration on both legs. Histopathologic finding revealed elongation and fusion of rete ridges and mild thickening of dermal capillaries.
Seung-Hwan Jeon,Seung-Weon Lim,Ki-Hyun Jung,Jae-Yun Jeon,Sang-Yoon Kim,Ji-Young Kim,Yoon-Young Choi,Kyung-Gyun Hwang 대한악안면성형재건외과학회 2023 Maxillofacial Plastic Reconstructive Surgery Vol.45 No.-
Background The primary objective of this study was to assess the clinical effectiveness of fused images obtained from single-photon emission computed tomography (SPECT) and facial computed tomography (CT) for evaluating degenerative changes in the mandibular condylar head. This assessment was accomplished by comparing the Technetium-99 m methylene diphosphonate (99mTc-MDP) uptake ratio with the results of clinical and radiographic findings. Methods The study included 17 patients (3 males and 14 females) with suspected osteoarthritis of the mandibular condyle, totaling 34 temporomandibular joints (TMJs). Based on clinical and radiographic examinations, the TMJs were categorized into four groups: normal (group N), internal derangement (group ID), osteoarthritis (group OA), and osteoarthritis sequelae (group OAseq). For each patient, bone SPECT and facial CT scans were registered and reconstructed to create fused SPECT/CT images. The 99mTc-MDP uptake levels in the TMJs were statistically compared among the four groups. Results The 99mTc-MDP uptake ratio showed a gradual increase in the order of the following: group N, group OAseq, group ID, and group OA. There was a significant difference observed among groups (p = 0.003), mainly driven by the disparity between group OA and both group N (p < 0.001) and group OAseq (p = 0.048). Conclusion Fused SPECT/CT image can be an effective tool for evaluating degenerative changes in the mandibular condylar head. The technique demonstrated the ability to differentiate between normal TMJs and those with internal derangement, osteoarthritis, or osteoarthritis sequelae. This approach holds promise as a valuable method in clinical assessments of TMJ degeneration.
Thermodynamics of Formate-Oxidizing Metabolism and Implications for H<sub>2</sub>Production
Lim, Jae Kyu,Bae, Seung Seob,Kim, Tae Wan,Lee, Jung-Hyun,Lee, Hyun Sook,Kang, Sung Gyun American Society for Microbiology 2012 Applied and environmental microbiology Vol.78 No.20
<B>ABSTRACT</B><P>Formate-dependent proton reduction to H2(HCOO<SUP>−</SUP>+ H2O → HCO3<SUP>−</SUP>+ H2) has been reported for hyperthermophilicThermococcusstrains. In this study, a hyperthermophilic archaeon,Thermococcus onnurineusstrain NA1, yielded H2accumulation to a partial pressure of 1 × 10<SUP>5</SUP>to 7 × 10<SUP>5</SUP>Pa until the values of Gibbs free energy change (Δ<I>G</I>) reached near thermodynamic equilibrium (−1 to −3 kJ mol<SUP>−1</SUP>). The bioenergetic requirement for the metabolism to conserve energy was demonstrated by Δ<I>G</I>values as small as −5 kJ mol<SUP>−1</SUP>, which are less than the biological minimum energy quantum, −20 kJ mol<SUP>−1</SUP>, as calculated by Schink (B. Schink, Microbiol. Mol. Biol. Rev. 61:262-280, 1997). Considering formate as a possible H2storage material, the H2production potential of the strain was assessed. The volumetric H2production rate increased linearly with increasing cell density, leading to 2,820 mmol liter<SUP>−1</SUP>h<SUP>−1</SUP>at an optical density at 600 nm (OD600) of 18.6, and resulted in the high specific H2production rates of 404 ± 6 mmol g<SUP>−1</SUP>h<SUP>−1</SUP>. The H2productivity indicates the great potential ofT. onnurineusstrain NA1 for practical application in comparison with H2-producing microbes. Our result demonstrates thatT. onnurineusstrain NA1 has a highly efficient metabolic system to thrive on formate in hydrothermal systems.</P>