http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
박철근,고경혁 慶尙大學校 1988 論文集 Vol.27 No.1
1984년 1월부터 1987년 7월까지 경상대학교 의과대학 병리학교실에서 진단한 55예의 유방이형성증을 병리학적으로 재검색하여 다음의 결과를 얻었다. 1. 유방이성형증의 평균 발생연령은 35·6세이었다. 2. 유방이성형증에 속하는 각 병변들 중 선증이 가장 많았고 이어서 섬유증, 상피세포증생, 섬유선종증, 아포크라인화생, 미세낭종의 순이었으며, 거대낭종은 관찰되지 않았다. 3. 미세낭종은 선증에서 생기는 것으로 생각되며, 여기에는 아포크리인화생이 관여할 것으로 생각된다. 4. 섬유선종증과 순수한 섬유증은 유방이성형증에서 제외되어야 할 것으로 생각된다. The following results were obtained from the pathological study of 55 cases of mammary dysplasia. 1. The average age of patients of mammary dysplasia was 35.6 years. 2. Adenosis was the most frequent component of mammary dysplasia, followed by fibrosis, epithelial hyperplsia, fibroadenomatosis, apocrine metaplasia and microcyst. Gross cysts were not observed. 3. Adenosis appeared to be a precursor to microcyst formation, and the process seemed to be influenced by apocrine metaplasia. 4. Fibroadenomatosis and pure primary fibrosis were thought to be excluded from mammary dysplasia.
9,10-Dimethyl-1,2-Benzanthrance 투여 후 백서 뇌하수체 Prolactin 분비세포의 변화
이상훈,박철근,고경혁 慶尙大學校 1990 論文集 Vol.29 No.2
An immunohistochemical study on the prolactin cells was carried out to investigate the change of number of prolactin-secreting cells in 9,10-dimethy1-1,2-benzanthracene (DMBA)-treated rats. Female Sprague-Dawley rats were givenDMBA suspended in sesame oil by gastric intubation using oral zonde needle. At 70 days of age, each animal received a single feeding of DMBA(12mg/100 gm body weight). Five rats bearing DABA-induced mammary carcinoma and ten rats not bearing mammary carcinoma after DMBA adminstration were used as experimental group. Nine rats were given sesame oil at 70 days of age, and were used as control group. Representative transverse sections of the pituitary gland from each rat were immunostained with rabbit anti-rat prolactin by Avidin-Biotin-Peroxidase Complex(ABC) method. Following results were obtained : 1. Prolactin-secreting cells were more frequently observed in the peripheral region than in the central region of adenohypophysis, in both DMBA-treated and untreated rats. 2. The number of prolactin-secreting cells of DMBA-treated rat bearing mammary carcinomas was significantly greater than that of DMBA-treated rats not bearing mammary carcinoma. 3. The number of prolactin-secreting cells of DMBA-treated rats was significantly greater than that of untreated rats. Based on the findings above, it is assumed that mammary carcinoma of DMBA-treated rats is induced by increase of prolactin-secreting cells in pituitary gland.
고경혁(Gyung-Hyuck Ko),이근회(Keun-Hoi Lee),조성환(Sung-Hwan Cho) 한국식품영양과학회 1995 한국식품영양과학회지 Vol.24 No.5
광범위한 천연항균제로 그 활용이 고려되고 있는 grapefruit 종자추출물의 안전성을 검토하기 위하여 급성 경구독성, 피부자극 및 급성 안점막 자극시험을 수행하였다. 실험 흰쥐에 대한 급성 LD_(50)값은 3.75g/㎏이었으며, 피부에 대한 독성은 약한 편으로 부종 등의 병변이 거의 생기지 않았으나 눈에 대한 자극성이 있는 것으로 나타났다. Effects of grapefruit seed extract on the lethality, the primary skin irritation, and the acute eye irritation potentials were evaluated in rats. The acute oral LD_(50) of GFSE for Sprague-Dawley derived rats was 3.75g/㎏ with 95% confidence limits of 2.55 and 5.52g/㎏. Patch application to the intact and abraded skin of rabbits led to mild to moderate erythema and no or mild edema. Application to the eyes of rabbits led to severe corneal opacity, iritis, conjunctival erythema, edema, and discharge.
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.