수수 타닌의 Fe(II) 킬레이트

정양숙,서효식,배도규,Jung, Yang Sook,Seo, Hyo Sik,Bae, Do Gyu 경북대학교 농업과학기술연구소 2015 慶北大農學誌 Vol.33 No.1

본 연구에서는 수수 등겨에 함유되어 있는 타닌의 새로운 천연 색소자원으로서의 활용 가능성을 알아보기 위해서 추출된 색소의 성분을 조사하였으며, Fe와의 킬레이트 반응 조건과 킬레이트화 색소에 대한 여러 가지 특성이 조사되었다. 수수 등겨로부터 추출된 수용액의 흡수 스펙트럼에서는 자외선 영역인 281 nm에서 타닌에 의한 최대 흡수 peak을 보여주고 있다. pH 조건에 따른 킬레이트화 반응에서는 pH 7.5의 반응 조건이 가장 효과적이었다. Fe 농도 2 mg/L 까지는 킬레이트화 반응이 급격히 증가하나, 그 이상의 농도에서는 더 이상의 추가적인 킬레이트화는 없는 것으로 나타났다 킬레이트화 된 타닌 색소의 입자 크기는 $4.5{\sim}17{\mu}m$, $20{\sim}42{\mu}m$, $45{\sim}80{\mu}m$, $83{\sim}160{\mu}m$ 범위의 네 그룹으로 나누어지는 것을 확인 할 수 있었다. DSC 분석에서는 타닌의 킬레이트화에 따라 열분해에 기인한 흡열 peak가 크게 증가($318^{\circ}C{\rightarrow}415^{\circ}C$)한다는 것을 확인 할 수 있었으며, TGA 분석에서도 열분해 시작 온도가 $253^{\circ}C$에서 $382^{\circ}C$까지 상승하는 것을 알 수 있어, 킬레이트화는 열 안정성을 향상시킨다는 것을 확인하였다. This study investigated the chelation of a sorghum bran extract using iron (Fe) as a new natural colorant. The composition of the sorghum bran extract and chelation conditions were both examined. The thermal properties of the chelated colorants were analyzed using differential scanning calorimetry (DSC) and a thermal analyzer system(TGA). The sorghum bran extract solution showed a maximum absorbance at 281 nm based on UV/Vis spectrophotometry. According to the chelation pH conditions, pH 7.5 was the most effective. The chelation of the sorghum bran extract increased rapidly when increasing the iron concentration up to 2 mg/L, with no further chelation at a higher concentration. The particle size distribution curve for the chelated tannin revealed four groups: $4.5{\sim}17{\mu}m$, $20{\sim}42{\mu}m$, $45{\sim}80{\mu}m$, and $83{\sim}160{\mu}m$. In a DSC analysis, endothermic peaks attributed to the pyrolysis of the extract and chelated tannin were found at $318^{\circ}C$ and $415^{\circ}C$, respectively. In a TGA analysis, the chelation was shown to increase the final degradation temperature from $253^{\circ}C$ to $382^{\circ}C$, confirming that the chelation improved the thermal stability.

황토를 이용한 인견직물의 천연염색

정양숙,배도규,Jung, Yang-Sook,Bae, Do-Gyu 경북대학교 농업과학기술연구소 2013 慶北大農學誌 Vol.31 No.3

본 연구에서는 황토를 이용한 인견직물의 천연염색에 대한 연구의 일환으로, 인견직물의 카티온화가 이루어졌으며, 여러가지 염색조건 즉 염색온도, 염색시간, 염색 pH와 욕비에 따른 염착특성을 평가하여 적정 염색조건을 설정하였으며 이에 따른 염색된 인견직물의 견뢰도 평가를 통해 다음과 같은 결과를 얻었다. 수비법으로 얻은 황토분말의 입자 크기는 $0.4{\sim}1.7{\mu}m$ 범위로 나타났으며 $1.1{\sim}1.4{\mu}m$범위내의 분포가 가장 많은 것으로 나타났다. 황토성분을 분석한 결과, 이산화규소와 산화알루미늄이 많은 양을 차지하는 것으로 나타났다. 인견 직물의 암모늄기의 도입에 의한 양이온화는 FT-IR 흡수스펙트럼에서 $1,540cm^{-1}$ 부근의 N-H bending에 의한 출현 peak로 확인할 수 있었다. 염색 pH에 따른 K/S 값은 pH 8에서 가장 높게 나타났으며, 염색시간에 따른 K/S 값은 시간이 경과함에 따라 염색시간 30분까지는 급격히 증가하다가 그 이상의 시간에서는 거의 증가하지 않았다. 황토농도에 따른 K/S 값은 20% 이하의 농도에서는 약간 증가하지만 30%에서 최고값을 보여준 후 점차 감소하는 경향으로 나타났다. 콩즙의 전처리농도에 따른 K/S 값은 처리농도 30% 까지는 증가하였으나 그 이상의 농도에서는 오히려 약간 감소하는 경향으로 나타났다. 황토염색직물의 황토염착 분포 및 염착 상태를 관찰한 결과 황토 염색 농도가 증가함에 따라 황토입자의 부착량이 많아짐을 알 수 있다. 양이온화 처리에 의해서도 황토의 부착량이 증가하는 것을 볼 수 있으며, 콩즙을 처리하면 콩즙이 직물의 표면을 감싸는 모습을 볼 수 있으며, 콩즙을 처리하지 않은 시료에 비해 콩즙을 전처리한 시료에 더 많은 양의 황토입자가 부착되어 있는 것을 확인할 수 있다. This study dyed rayon fabric using loess as a natural colorant. To obtain the optimal dyeing conditions, various dyeing conditions were examined (temperature, pH, time, and concentration). The color fastness was evaluated using standard washing and rubbing fastness tests. The results were as follows: The loess powder particle size ranged from 0.4 to $1.7{\mu}m$ with a distribution range of 1.1 to $1.4{\mu}m$, representing a fine and uniform manufactured loess powder. The loess component analysis showed a large amount of silicon dioxide and aluminum oxide. TheFT-IR spectra showed that the ammonium group in the rayon fabric produced N-H banding at $1,540cm^{-1}$. The highest K/S value for the rayon fabric was obtained when the pH was 8.0, and this value increased rapidly with a longer dyeing time and when increasing the loess concentration to 30% (w/v). Pre-treatment with a soybean solution produced the highest K/S value for the rayon fabric with a loess concentration of 30% (w/v). The SEM analysis showed a higher amount of loess adhered to the rayon fabric surface when increasing the loess concentration. However, pre-treatment with a cationic agent and soybean solution resulted in a much higher attachment of loess to the fabric surface. Thus, the experimental results showed that using a cationized fabric and pre-treatment with a soybean solution are more effective when dyeing rayon fabric with loess than when using only loess.

Calcium Hydroxide에 의한 Silk의 정련

정양숙 ( Yang Sook Jung ),김정호 ( Jeong Ho Kim ),배도규 ( Do Gyu Bae ) 한국잠사학회 2003 한국잠사곤충학회지 Vol.45 No.1

검정팥 종피 추출물에 의한 천연염색

차해숙,정양숙,배도규,Cha, Hae-Suk,Jung, Yang-Sook,Bae, Do-Gyu 경북대학교 농업과학기술연구소 2012 慶北大農學誌 Vol.30 No.2

본 연구에서는 검정팥 종피에 함유된 천연색소에 대한 연구의 일환으로, 천연염료로서의 적용을 위해 염색조건 즉 염색온도, 염색시간, 염색 pH, 욕비에 따른 K/S 값을 측정하여 적정 염색조건을 설정하고, 여러 매염제를 적용하여 색상변화에 미치는 영향 및 견뢰도를 측정하여 다음과 같은 결과를 얻었다. 1. pH에 따른 염색성에서는 견직물의 경우 pH 4에서 가장 염착량이 많았고, 면직물의 경우에는 주어진 범위 내에서 는 pH가 높을수록 염착량이 많았다. 2. 염색온도와 시간에 따른 염색성은, 견직물의 경우, 염색온도 $40^{\circ}C$와 $60^{\circ}C$에서는 전반적으로 염착량이 낮고 시간에 따른 염착량의 차이도 크지 않았으나 염색온도 $80^{\circ}C$에서는 시간이 경과할수록 K/S 값이 크게 나타났다. 면직물의 경우도 견직물과 비슷한 결과로 온도가 높아질수록 염색시간이 경과될수록 K/S 값이 크게 나타났다. 3. 견직물에 대한 매염제 종류별 표면색의 변화에서는 Fe 매염포만 YR${\rightarrow}$Y 로 변화되었을 뿐 다른 매염제에서는 매염후에도 색상 변화는 크지 않았다. Sn 매염과 Ti 매염포는 무 매염포 보다 $L^*$값이 상승하였으나 나머지 매염제는 $L^*$값이 크게 감소되었다. 면직물에 대한 표면색의 변화는 견직물에서와 같은 경향으로 나타났으며, $L^*$값에 있어서는 견직물과 다르게 Ni 매염포만 무매염포보다 $L^*$ 값이 크게 나타났다. 4. 매염처리 전 견직물의 일광 견뢰도는 무매염이 4~6등급, Al 처리포는 4~5등급, Cu와 Sn은 3~4등급으로 나타났고 Fe는 2~3등급으로 가장 낮게 나타났으며, 세탁견뢰도에서는 무매염 2등급, 매염제 처리포는 전부 2내지 3등급으로 나타났다. 무매염 면직물의 일광견뢰도는 1~2등급, Fe 매염은 2~3등급, Cu 2등급 Al과 Sn은 1~2등급으로 매염처리에 의해 전혀 개선되지 않았으며, 세탁견뢰도의 경우 Cu매염이 4등급으로 양호하게 나타났으며 무매염, Al, Sn과 Fe는 3등급으로 나타났다. In this study the natural colorant was extracted from black bean seed coat in aqueous solution and used to dye silk and cotton fabrics. To obtain the optimal dyeing conditions it was examined at various dyeing condition (temperature, pH, time and liquor ratio). The dyeing behavior and the depths of shade which were evaluated in terms of K/S and CIELAB color difference values of the dyed and mordanted fabrics were also investigated. The dyeing fastness evaluated standard light and wash fastness tests. The obtained results were as follows ; The most K/S value of silk and cotton fabrics were obtained when the pH was 4.0 and 4.8, respectively and it increased slightly with dyeing time passes when the dyeing temperatures were at $40^{\circ}C$ and $60^{\circ}C$ but, it increased at $80^{\circ}C$. The color of silk fabrics changed from yellowish red to yellow at only Fe mordanting among various mordanting. Sn and Ti mordanting of silk fabric and only Ni mordanting of cotton fabric increased the $L^*$ values, but the others decreased. The light fastness of silk fabrics showed 4-6 grade without mordant, 4-5 grade with Al, 3-4 grade with Cu and Sn, and 2-3 grade with Fe as mordant, and that of cotton fabrics showed 1-2 grade without mordant, 2-3 grade with Fe, 2 grade with Cu, 1-2 grade with Al and Sn as mordants. All mordanting coluld not improve the light fastness of fabrics. Washing fastness(fade) of silk fabrics showed 2 grade without mordants and 2-3 grade with mordants and those of cotton fabrics showed 4 grade with Cu, 3 grade without mordant and with Al, Sn and Fe. All of the washing fastness(stain) of both fabrics showed 4-5 grade.

산비장이(Serratuls coronate var. insularis Kitamura)를 이용한 직물의 천연염색

황보수정 ( Soo Jeung Hwangbo ),정양숙 ( Yang Sook Jung ),배도규 ( Do Gyu Bae ) 한국잠사학회 2006 한국잠사곤충학회지 Vol.48 No.2

본 연구는 우리 야생화중 비교적 대량번식이 가능한 종인 산비장이의 줄기, 꽃, 잎을 채취하여 염액을 추출하고, 다양한 염색 조건에서 견과 면 소재를 염색하여 염색거동을 살펴보고 염색된 색상에 대하여 고찰하여 다음과 같은 결과를 얻었다. 1. pH에 따른 염색에서 견은 pH가 낮을수록 진하게 염색되었고 면은 pH가 중성일 때 가장 진하게 염색되었다. 2. 염색온도에 따른 염착량은 견과 면 구분 없이 큰 차 이가 없었다. 3. 염색시간이 1시간에서 2시간 사이에서 급격한 Y값의 감소를 보여 이 시간대에서 많은 염착이 이루어 졌다. 4. 면은 염 첨가 농도로 높을수록 Y값이 낮아져 염이 촉염효과 역할을 하는 것으로 보여 졌으나 견의 경우 염 첨가에 따른 Y의 값은 큰 변화가 없는 것으로 나타났다. 5. 염액 농도에 따른 염색성은 견, 면 모두 농도가 작아지면 염착량이 작아졌다. 6. 견의 경우 매염제의 대한 매영효과가 높에 나타나고 있으나 매염제 농도는 큰 영향을 미치지 않았다. 면에서 철(Fe)과 구리(Cu)에 대한 매염효과만 조금 있었다. In this thesis, we took some stalks, flowers, and leaves of the Serratuls coronate var. insularis which are able to propagate as mass in our wild to extract the dyeing solution, and cotton and silk were dyed using them in many different conditions. Silk was dyed darker than cotton. We found there was not a big difference between silk and cotton in the given condition considering ``Y`` values vs. dyeing temperature. There was a rapid decreasing of ``Y`` values after one to two hours and almost all of dyeing was completed at these times. We found there was a dyeing acceleration at the higher dyeing density and the lower ``Y`` value. If the density was low, dyeing attachment was reduced by dyeing ability via the density of liquid in both plants. Silk was affected higher by mordant dyes in both plants. Fe and Cu had an effect by mordant dyes slightly an Serratuls coronate var. insularis.

물레나물(Hypericum ascyron L.)을 이용한 직물의 천연염색

황보수정 ( Soo Jeung Hwangbo ),정양숙 ( Yang Sook Jung ),배도규 ( Do Gyu Bae ) 한국잠사학회 2005 한국잠사곤충학회지 Vol.47 No.2

위장관 10 : 영아에서 Helicobacter pylori 감염과 혈중 비타민 C 농도와의 관계

김은아(E . A . Kim),신선경(S . K . Shin),정양숙(Y . S . Jung),임재영(J . Y . Lim),박찬후(C . H . Park),우향옥(H . O . Park),윤희상(H . S . Youn),고경혁(G . H . Ko),백승철(S. C. Baik),이우곤(W . K . Lee),조명제(M . J . Cho),이광호(K . H 대한소화기학회 1998 대한소화기학회 추계학술대회 Vol.1998 No.-

표준화환자를 활용한 건강사정 실습교육이 간호학생의 간호수행능력, 의사소통능력 및 학습만족도에 미치는 효과

최선주(Choi, Sun Ju),권말숙(?Kwon, Mal Suk),김선화(Kim, Seon Hwa),김현미(Kim, Hyeon Mi),정양숙(Jung, Yang Sook),조금이(Jo, Geum Yi) 한국간호교육학회 2013 한국간호교육학회지 Vol.19 No.1

Purpose: The purpose of this study was to evaluate the effects of using standardized patients on nursing competence, communication skills, and learning satisfaction in health assessment. Method: This study was a nonequivalent control group non-synchronized post-test design. Study participants were recruited from third-year nursing students at a university. The data were analyzed using the SPSS/WIN 18.0 program. Results: The mean scores of nursing competence and communication skills were significantly higher in the experimental group than the control group. However, the two groups were not statistically different in learning satisfaction. Conclusion: The findings suggest that the use of standardized patients compared to the traditional method is an effective educational method for health assessment in nursing competence and communication skills. Therefore, it is necessary to develop various scenarios and apply standardized patients for health assessment. In addition, further research is required to evaluate its effects.

영아에서 Helicobacter pylori 감염에 대한 항체반응

임재영,고경혁,조명제,김은아,김윤옥,윤희상,백승철,이우곤,이광호,우향옥,박찬후,정양숙 대한소화기학회 2000 대한소화기학회지 Vol.35 No.6

Background/Aims: The early stage of Helicobacter pylori (H. pylori) infection may show only anti-H. pylori IgM antibody response in young infants. We tried to find out the antigens of H. pylori which stimulate antibody response during the early stage of infection using IgM, IgA, and IgG immunoblot analyses. Methods: Sera of 48 infants were collected at birth and 7 months of age under the permission of parents and sera of 17 infants were also collected at 3 months and 9 months after birth. For those sera, IgM, IgA, and IgG immunoblotting were performed. Results: At the first study, seventeen of 48 (35.4%) infants show 120 kDa band on IgM or IgA immunoblot at 7 months of age. Four infants showed 120 kDa band on IgM immunoblot but not on IgA immunoblot. They were assumed to be infected very recently. At the second study, 2 of 17 showed strong IgM immune response to H. pylori at 3 months of age. The 120, 61, 60, 56, 54, 35, 29, 25, 18 kDa bands were recognized on IgM immunoblot in both studies. Conclusions: At 7 months of age, 35.4 % of infants were infected with H. pylori. Antigens of H. pylori which stimulate antibody response during the early stage of human infection were 120, 61, 60, 56, 54, 47, 29, 25, 18 kDa.

소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계

임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1

Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.