Isovitexin Protects Mice from Methicillin- Resistant Staphylococcus aureus-Induced Pneumonia by Targeting Sortase A

( Lili Tian ),( Xinliang Wu ),( Hangqian Yu ),( Fengying Yang ),( Jian Sun ),( Tiezhong Zhou ),( Hong Jiang ) 한국미생물생명공학회 2022 Journal of microbiology and biotechnology Vol.32 No.10

The rise of methicillin-resistant Staphylococcus aureus (MRSA) has resulted in significant morbidity and mortality, and clinical treatment of MRSA infections has become extremely difficult. Sortase A (SrtA), a virulence determinant that anchors numerous virulence-related proteins to the cell wall, is a prime druggable target against S. aureus infection due to its crucial role in the pathogenicity of S. aureus. Here, we demonstrate that isovitexin, an active ingredient derived from a variety of traditional Chinese medicines, can reversibly inhibit SrtA activity in vitro with a low dose (IC₅₀=24.72 μg/ml). Fluorescence quenching and molecular simulations proved the interaction between isovitexin and SrtA. Subsequent point mutation experiments further confirmed that the critical amino acid positions for SrtA binding to isovitexin were Ala-92, Ile-182, and Trp-197. In addition, isovitexin treatment dramatically reduced S. aureus invasion of A549 cells. This study shows that treatment with isovitexin could alleviate pathological injury and prolong the life span of mice in an S. aureus pneumonia model. According to our research, isovitexin represents a promising lead molecule for the creation of anti-S. aureus medicines or adjuncts.

Serial Frozen Fecal Microbiota Transplantation in the Treatment of Chronic Intestinal Pseudo-obstruction: A Preliminary Study

( Lili Gu ),( Chao Ding ),( Hongliang Tian ),( Bo Yang ),( Xuelei Zhang ),( Yue Hua ),( Yifan Zhu ),( Jianfeng Gong ),( Weiming Zhu ),( Jieshou Li ),( Ning Li ) 대한소화기기능성질환·운동학회(구 대한소화관운동학회) 2017 Journal of Neurogastroenterology and Motility (JNM Vol.23 No.2

Background/Aims Chronic intestinal pseudo-obstruction (CIPO) is a serious, life-threatening motility disorder that is often related to bacterial overgrowth. Fecal microbiota transplantation (FMT) results in restoration of the normal intestinal microbial community structure. We investigated the efficacy of FMT in the treatment of CIPO patients. Methods Nine patients (age 18-53 years) with CIPO were enrolled in this prospective, open-label study. Patients received FMT for 6 consecutive days through nasojejunal (NJ) tubes and were followed up for 8 weeks after treatment. We evaluated the rate of clinical improvement and remission, feeding tolerance of enteral nutrition, and CT imaging scores of intestinal obstructions. Lactulose hydrogen breath tests were performed before FMT and 8 weeks after FMT to evaluate for the presence small intestinal bacterial overgrowth (SIBO). Results FMT significantly alleviated bloating symptoms, and symptoms of pain were relieved 2 weeks after FMT. Enteral nutrition administered through a NJ tube after FMT was well-tolerated by 66.7% (6/9) of patients. CT scores of intestinal obstructions were significantly reduced after FMT (P = 0.014). SIBO was eliminated in 71.0% (5/7) of patients. Conclusions This pilot study demonstrated the safety of using FMT. FMT may relieve symptoms in selected patients with CIPO. FMT may also improve patient tolerance of enteral nutrition delivered via a NJ tube. (J Neurogastroenterol Motil 2017;23:289-297)

Acupuncture for Osteoporosis: a Review of Its Clinical and Preclinical Studies

Tian Yimiao,Wang Lili,Xu Tianshu,Li Rui,Zhu Ruyuan,Chen Beibei,Zhang Hao,Xia Bingke,Che Yiwen,Zhao Dandan,Zhang Dongwei 사단법인약침학회 2022 Journal of Acupuncture & Meridian Studies Vol.15 No.5

Acupuncture has gained growing attention in the management of osteoporosis (OP). However, a comprehensive review has not yet been conducted on the efficacy and challenges of acupuncture in preliminary research and clinical trials. Therefore, an extensive literature search was conducted using electronic databases, including PubMed (www.ncbi.nlm.nih.gov/pubmed), CNKI (www.cnki.net), and Web of Science, for studies published from the beginning of 2000 to the end of May 2022. Combinations of synonyms for OP, acupuncture, traditional Chinese medicine, clinical trial, preclinical study, and animal experiments were searched. A total of 290 papers were consulted, including 115 reviews, 109 clinical observations, and 66 preclinical studies. There is accumulating evidence to support the beneficial role of acupuncture in preserving bone quality and relieving clinical symptoms based on clinical and preclinical investigations. The top ten most commonly used acupoints are BL23, ST36, BL20, BL11, CV4, GV4, SP 6, KI3, BL18, and GB39. The underlying mechanisms behind the benefits of acupuncture may be linked with the regulation of the hypothalamic-pituitary-gonadal (adrenal) axis and activation of the Wnt/β-catenin and OPG/RANKL/RANK signaling pathways. In summary, strong evidence may still come from prospective and well-designed clinical trials to shed light on the potential role of acupuncture in preserving bone loss. Future investigations are needed to explore the potential underlying mechanisms, long-term clinical efficacy, and compliance of acupuncture in OP management.

Chemerin/CMKLR1 pathway exacerbates cisplatin-induced spiral ganglion neuron injury

Tian Jie,Mu Ying,Ma Lili 한국독성학회 2024 Toxicological Research Vol.40 No.1

This study investigated whether chemerin/chemokine-like receptor 1 (CMKLR1) pathway participate in cisplatin‐induced spiral ganglion neuron (SGN) damage. Middle cochlear turn was collected from C57BL/6 mice and the SGNs were cultured. Cisplatin, 2-(anaphthoyl) ethyltrimethylammonium iodide (α-NETA), or recombinant mouse chemerin was added into the medium for the treatment. Relative mRNA and protein expression was determined by RT-PCR, ELISA and Western blot, respectively. In cultured mouse cochlear SGNs, the treatment of cisplatin enhanced the secretion of chemerin and CMKLR1. Recombinant chemerin promoted but α-NETA inhibited chemerin/CMKLR1 pathway in cisplatin stimulated SGNs. Cisplatin-induced apoptosis and inflammation response in SGNs were enhanced by recombinant chemerin while inhibited by α-NETA. Recombinant chemerin promoted but α-NETA inhibited NF-κB signal in cisplatin stimulated SGNs. In conclusion, chemerin/CMKLR1 pathway regulated apoptosis and inflammation response in cisplatin-induced SGN injury through NF-κB signaling pathway.

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...

Grape seed proanthocyanidins protect retinal ganglion cells by inhibiting oxidative stress and mitochondrial alteration

Linlin Li,Xing Geng,Lili Tian,Dabo Wang,Qin Wang 대한약학회 2020 Archives of Pharmacal Research Vol.43 No.10

Grape seed proanthocyanidins (GSP) are knownas condensed tannins and have been used as an anti-oxidantin various neurodegenerative diseases. In our study, GSPwas used as a daily dietary supplement and the neuroprotectiveeffects were evaluated on the retinal ganglion cells(RGCs) in the retinal tissues in glaucomatous DBA/2D (D2)mice. D2 mice and age-matched non-glaucomatous DBA/2JGpnmb+(D2-Gpnmb+) mice were fed with GSP or a controldiet for up to 6 months. The intraocular pressure (IOP), RGCsurvival, glial fibrillary acidic protein (GFAP), the levels ofapoptotic proteins, and the expression of oxidative stressmarkers in retinal tissues were determined. In our study, theneuroprotective effects of GSP on retinal tissues were confirmed,as evidenced by (a) GSP inhibited the IOP elevationin D2 mice; (b) GSP enhanced RGC survival and mediatedthe apoptotic protein expression; (c) GSP suppressed GFAPexpression; and (d) the oxidative stress and the levels ofmitochondrial reactive oxygen species were regulated byGSP. Our findings indicate that GSP has promising potentialto preserve retinal tissue functions via regulating oxidativestress and mitochondrial functions.

Enhanced photocatalytic activity of TiO2/graphene by tailoring oxidation degrees of graphene oxide for gaseous mercury removal

Yu Guan,Tao Hu,Jiang Wu,Lili Zhao,Fengguo Tian,Wei-Guo Pan,Ping He,Xuemei Qi,Fangqin Li,Kai Xu 한국화학공학회 2019 Korean Journal of Chemical Engineering Vol.36 No.1

We used a simple method of graphene oxide (GO) preparation with different oxidation levels, and control the properties of the TiO2 nanocrystals by tuning the content and oxidation degree of GO to enhance the photocatalytic performance. During the hydrothermal reaction, reduction of GO, formation of TiO2 and chemical bonds between TiO2 and reduced graphene oxide (RGO) was achieved simultaneously. Characterization results showed that TiO2 properties such as crystalline grain and particle size could be tailored by the amount of functional groups, and that crystallinity was also controlled by GO degrees of oxidation. TiO2/RGO photocatalysts showed great efficiency of mercury oxidation, which reached 83.7% and 43.6% under UV and LED light irradiation, respectively. The effects of crystalline grain size and surface chemical properties on Hg0 removal under LED and UV light irradiation were analyzed. In addition, the properties of the photocatalysts before and after UV illumination were investigated, finding that part of Ti-OH on TiO2 surface transformed to Ti-O-Ti. In a nutshell, this work could provide a new insight into enhancing activity of photocatalysts and understanding the photocatalytic mechanism.

Control Method of Self-Frequency Recovery and Active Power Sharing for an Isolated Microgrid Based on VSGs

Pengxiang Xing,Fan Ma,Chunzheng Tian,Changqing Xu,Lili Wang 대한전기학회 2019 Journal of Electrical Engineering & Technology Vol.14 No.1

The concept of virtual synchronous generator (VSG) is emerging as an attractive solution for renewable energies to enhance the microgrid inertia and damping property by emulating the essential behaviors of conventional synchronous generators. However, in the isolated microgrid based on VSGs, there will be a frequency deviation when the power demand varies because of the droop characteristic of the VSG in active power–frequency regulation. In this paper, a control method for VSGs to implement self-frequency recovery and active power sharing in isolated microgrid is proposed. With this method, the VSGs regulate their power baseline values over multiple iterations through local-feedback of the frequency deviation until the microgrid frequency restores to normal value, and simultaneously share the power demand variation according to the ratio of their power baseline values. Compared to the previous studies, the proposed method can eliminate the output power and frequency oscillations in secondary control, and additionally, reduce the dependence of the microgrid on communication system, which is beneficial to enhance the robustness of the microgrid operation. Simulation results proved the proposed method to be effective.

Heat Shock Protein 70 Expression is Increased in the Liver of Neonatal Intrauterine Growth Retardation Piglets

Li, Wei,Zhong, Xiang,Zhang, Lili,Wang, Yuanxiao,Wang, Tian Asian Australasian Association of Animal Productio 2012 Animal Bioscience Vol.25 No.8

Intrauterine growth retardation (IUGR) leads to the dysfunction in digestive system, as well as the alteration in the expression of some functional proteins. Heat shock protein 70 (Hsp70) could be induced by various stress factors, but whether Hsp70 expression is changed in neonatal IUGR infants has not been demonstrated. This study was conducted to explore the expression of Hsp70 in the liver by using the IUGR piglet model. Liver and plasma samples were obtained from IUGR and normal birth weight (NBW) piglets at birth. The neonatal IUGR piglets had significantly lower liver weight than their counterparts. The activities of aspartate aminotransferase and alanine aminotransferase in serum were enhanced significantly in IUGR indicating liver dysfunction. The activities of superoxide dismutase (p<0.01), glutathione peroxidase (p<0.01) and catalase (p>0.05) were lower and the level of malondialdehybe was higher (p<0.05) in IUGR liver compared with in NBW. According to the results of histological tests, fatty hepatic infiltrates and cytoplasmic vacuolization were present in the liver of IUGR piglets, but not in NBW liver. The expression of Hsp70 protein was significantly higher (p<0.05) in IUGR piglet liver than in NBW. Similar to where the hepatic injuries were observed, location of Hsp70 was mostly in the midzonal hepatic lobule indicating that oxidative stress might be responsible for the increased expression of Hsp70.

Effects of dietary leucine supplementation on the hepatic mitochondrial biogenesis and energy metabolism in normal birth weight and intrauterine growth-retarded weanling piglets

Weipeng Su,Wen Xu,Hao Zhang,Zhixiong Ying,Le Zhou,Lili Zhang,Tian Wang 한국영양학회 2017 Nutrition Research and Practice Vol.11 No.2

BACKGROUND/OBJECTIVES: The study was conducted to evaluate the effects of dietary leucine supplementation on mitochondrial biogenesis and energy metabolism in the liver of normal birth weight (NBW) and intrauterine growth-retarded (IUGR) weanling piglets. MATERIALS/METHODS: A total of sixteen pairs of NBW and IUGR piglets from sixteen sows were selected according to their birth weight. At postnatal day 14, all piglets were weaned and fed either a control diet or a leucine-supplemented diet for 21 d. Thereafter, a 2 × 2 factorial experimental design was used. Each treatment consisted of eight replications with one piglet per replication. RESULTS: Compared with NBW piglets, IUGR piglets had a decreased (P < 0.05) hepatic adenosine triphosphate (ATP) content. Also, IUGR piglets exhibited reductions (P < 0.05) in the activities of hepatic mitochondrial pyruvate dehydrogenase (PDH), citrate synthase (CS), α-ketoglutarate dehydrogenase (α-KGDH), malate dehydrogenase (MDH), and complexes I and V, along with decreases (P < 0.05) in the concentration of mitochondrial DNA (mtDNA) and the protein expression of hepatic peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α). Dietary leucine supplementation increased (P < 0.05) the content of ATP, and the activities of CS, α-KGDH, MDH, and complex V in the liver of piglets. Furthermore, compared to those fed a control diet, piglets given a leucine-supplemented diet exhibited increases (P < 0.05) in the mtDNA content and in the mRNA expressions of sirtuin 1, PGC-1α, nuclear respiratory factor 1, mitochondrial transcription factor A, and ATP synthase, H+ transporting, mitochondrial F1 complex, β polypeptide in liver. CONCLUSIONS: Dietary leucine supplementation may exert beneficial effects on mitochondrial biogenesis and energy metabolism in NBW and IUGR weanling piglets.