Horizontal dynamic modeling and vibration characteristic analysis for nonlinear coupling systems of high-speed elevators and guide rails

Danlong Song,Peng Zhang,Yuanhao Wang,Chunhua Du,Xiaomin Lu,Kai Liu 대한기계학회 2023 JOURNAL OF MECHANICAL SCIENCE AND TECHNOLOGY Vol.37 No.2

To study the horizontal vibration characteristics of high-speed elevators, a 6-DOF horizontal dynamic model of the nonlinear coupling system of guide rails, guide shoes, and elevator cabin was established. Four kinds of guide rail excitation models, namely, sinusoidal, triangular, stepped, and pulsed excitation, were established through an error and contact analysis of guide rails and rollers. The factors that influenced the horizontal vibration response, such as excitation models, stiffness of guide shoes, and cabin parameters, were analyzed by solving the vibration acceleration of the coupling system. Vibration acceleration was measured through experiments to verify the theoretical results. The vibration acceleration of the no-load elevator under stepped excitation was the largest. Reducing the stiffness of the guide shoes and straightness error of guide rails, reasonably arranging the spacing between the guide shoes at the top and bottom of the cabin, and increasing the cabin weight were beneficial to reducing the horizontal vibration response of the elevator cabin.

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...

The Coupling Effects of Water and Fertilizer on the Camellia Oleifera Growth and Fruition

Dekui Niu,Zhi Li,Xiaomin Guo,Wenyuan Zhang,Keyin Sheng,Weiping Qian,Huiwu Peng 한국토양비료학회 2014 한국토양비료학회 학술발표회 초록집 Vol.2014 No.6

Modeling and Virtual Screening of Antisense Peptides Targeting the Divergent Region of Tumor-Associated MT1-MMP Protein

Bowen Tan,Yijie Zhou,Zhilei Song,Yinxuan Peng,Fang Wu,Yue Kang,Xiaomin Liu,Li Zeng,Tingting Huang,Zongying Liu,Lili Xiong,Zhiyun Guo,Jian Cui,Canquan Mao 대한화학회 2015 Bulletin of the Korean Chemical Society Vol.36 No.9

Membrane type-1 matrix metalloproteinase (MT1-MMP; also known as MMP14) is a key enzyme involved in tumor invasion and metastasis, and is a potential target for drug discovery for cancer therapy. However, till now there is no MT1-MMP- or MMP-based anticancer drugs in the market mainly because of the high conservation of the MMP family and also because there is no elucidated crystal structure for the mature MT1-MMP. The modeling of the three-dimensional structure of mature MT1-MMP and the finding of MT1-MMP targeted peptides by virtual screening are highly desired. In this study, the three-dimensional structure of mature MT1-MMP is constructed by homology and de novo modeling and later rationalized and optimized by molecular dynamics simulations. An antisense peptide library was constructed against the divergent sense peptide DEGTEEET in the specific region of MT1-MMP, which was found by multiple alignment of the whole MMP family. The antisense peptide library was virtually screened against the constructed three-dimensional model of MT1-MMP. The top 20 novel peptides were further studied, which were found well docked with MT1-MMP at the region of DEGTEEET, again confirming their specific binding to MT1-MMP. Preliminary study of one of the top-ranked peptide SFLLSPFV showed that it could inhibit the viabilities of MG63 and MDA-MB-231 tumor cells. We thus not only successfully modeled the three-dimensional structure of mature MT1-MMP but also provided a new way for the finding of peptide candidates targeting MT1-MMP based on antisense peptide library.

Effectively remediating spiramycin from production wastewater through hydrolyzing its functional groups using solid superacid TiO₂/SO₄

Yang, Wen,Ok, Yong Sik,Dou, Xiaomin,Zhang, Yu,Yang, Min,Wei, Dongbin,Xu, Peng Elsevier 2019 Environmental research Vol.175 No.-

<P><B>Abstract</B></P> <P>Breaking down the structural bonds and eliminating the functional groups are more efficient than destroying the whole molecule in antibiotic production wastewater (APW) pretreatment before further biotreatment. Two sulfated titania (TiO<SUB>2</SUB>/SO<SUB>4</SUB>) solid superacids, SSA1 and SSA2 were synthesized, characterized and used for hydrolytic pretreatment of spiramycin in APW. Spiramycin removal followed an order of SSA2>SSA1>TiO<SUB>2</SUB>≈pH = 3>control. The hydrolytic efficiencies increased at elevated temperature from 25 °C to 65 °C. The hydrolytic kinetics followed a first-order model and SSA2 performed the fastest. The performances were positively correlated with both the total acidity determined by <I>n</I>-butylamine titration and the strength of acid sites measured by NH<SUB>3</SUB>-temperature-programmed desorption (TPD). The residual solution for SSA2 presented the least antibacterial potency and anaerobic inhibition among all treatments. The hydrolyzed product was identified as the <I>m/z</I> 699.4321 fragment using UPLC-Q/TOF-MS, which was formed after losing a functional mycarose moiety from the parent molecular. The solid superacids were effective in selectively eliminating 433 mg/L of spiramycin and the antibacterial potencies of the spiramycin production wastewater, which contained very high concentrations of COD (33,000 mg/L). This hydrolytic method avoids using and handling hazardous and corrosive mineral acids on site. It is attractive as a selective catalytic pretreatment method to cleave antibiotics’ functional groups and to reduce its inhibitory effects before sequential biotreatments.</P> <P><B>Highlights</B></P> <P> <UL> <LI> Solid superacids were made by calcining the reaction products of H<SUB>2</SUB>SO<SUB>4</SUB> and titania. </LI> <LI> Functional group breakage was catalyzed by the acid sites of solid superacids. </LI> <LI> The Lewis and Brønsted acidic sites all contributed to the hydrolytic reaction. </LI> <LI> The antibacterial potency and the anaerobic inhibition were effectively decreased. </LI> <LI> Superacids performed well in hydrolytic pretreatment of the production wastewater. </LI> </UL> </P>

The Diversity of Plants in Subalpine Meadows of Wugong Mountain in Jiangxi Province of China

Zhi Li,Wenyuan Zhang,Dekui Niu,Xiaomin Guo,Xia Gong,Xiaohua Wei,Weiping Qian,Huiwu Peng 한국토양비료학회 2014 한국토양비료학회 학술발표회 초록집 Vol.2014 No.6

Raman Lidar for the Measurement of Temperature, Water Vapor, and Aerosol in Beijing in the Winter of 2014

Min Tan,Zhen Shang,Chenbo Xie,Hui Ma,Qian Deng,Xiaomin Tian,Peng Zhuang,Zhanye Zhang,Yingjian Wang 한국광학회 2018 Current Optics and Photonics Vol.2 No.1

To measure atmospheric temperature, water vapor, and aerosol simultaneously, an efficient multi-function Raman lidar using an ultraviolet-wavelength laser has been developed. A high-performance spectroscopic box that utilizes multicavity interference filters, mounted sequentially at small angles of incidence, is used to separate the lidar return signals at different wavelengths, and to extract the signals with high efficiency. The external experiments are carried out for simultaneous detection of atmospheric temperature, water vapor, and aerosol extinction coefficient in Beijing, under clear and hazy weather conditions. The vertical profiles of temperature, water vapor, and aerosol extinction coefficient are analyzed. The results show that for an integration time of 5 min and laser energy of 200 mJ, the mean deviation between measurements obtained by lidar and radiosonde is small, and the overall trend is similar. The statistical temperature error for nighttime is below 1 K up to a height of 6.2 km under clear weather conditions, and up to a height of 2.5 km under slightly hazy weather conditions, with 5 min of observation time. An effective range for simultaneous detection of temperature and water vapor of up to 10 km is achieved. The temperature-inversion layer is found in the low troposphere. Continuous observations verify the reliability of Raman lidar to achieve real-time measurement of atmospheric parameters in the troposphere.

The Soil Acidity on Wugong Mountain’s Meadow Degradation Areas

Ziwen Zhao,Wenyuan Zhang,Zhi Li,Dekui Niu,Xiaomin Guo,Shangshu Huang,Weiping Qian,Huiwu Peng 한국토양비료학회 2014 한국토양비료학회 학술발표회 초록집 Vol.2014 No.6