http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
- 中文 을 입력하시려면 zhongwen을 입력하시고 space를누르시면됩니다.
- 北京 을 입력하시려면 beijing을 입력하시고 space를 누르시면 됩니다.
RISS 인기검색어
- 검색키워드
- 저자 : Shujuan Cui (검색결과 4 건)
- 무료
- 기관 내 무료
- 유료
-
Research of Structural Risks of Object-Oriented Software Based on Ripple Degree of Software Network
Shujuan Cui,Sheng Bin,Gengxin Sun 보안공학연구지원센터 2016 International Journal of Multimedia and Ubiquitous Vol.11 No.1
Object-oriented software systems emerge from mere keystrokes to form intricate functional networks connecting many collaborating objects. In this paper, building on complex networks, software collaboration networks contained within several open-source software systems have been examined. Because of the association between objects, the ripple effect exists in those software networks. The distributions of forward and reversal ripple degree in software networks are analyzed, and focusing on high ripple degree nodes, a metric formula that evaluates the significance is presented. According to our metric, the fragile nodes, rigid nodes and a “hidden danger” node in software system can be selected, which can be used to provide guidance for design and remodeling of software systems.
-
Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012
Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6
In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...
-
-
Xiaolei Liu,Hongtao Cui,Xiaojing Hao,Shujuan Huang,Gavin Conibeer 한국물리학회 2017 THE JOURNAL OF THE KOREAN PHYSICAL SOCIETY Vol.71 No.12
Molybdenum (Mo) thin films are still a dominant choice for the back contact layer of Cu(In,Ga)Se2 (CIGS) and Cu2ZnSnS4 (CZTS) solar cells. This paper presents a review of Mo back contacts for CIGS and CZTS solar cells, including the requirements for a good back contact, the reason for the choice of Mo, and post-treatment. Additionally, a Mo bilayer back contact was fabricated by varying the argon (Ar) pressure during sputtering to provide both low resistivity and good adhesion to the soda-lime glass substrate. The effects of vacuum thermal annealing on the electrical, morphological and structural properties of the Mo bilayer were also investigated. Vacuum thermal annealing was seen to densify the Mo bilayer, reduce the sheet resistance, and improve the bilayer’s adhesion to the soda-lime glass. The Mo bilayer back contact with a low sheet resistance of 0.132 / and strong adhesion was made for chalcogenide- and kesterite-based solar cells.
연관 검색어 추천
이 검색어로 많이 본 자료
활용도 높은 자료
