http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
Research Progress of Visual Inspection of Tray Seedling and the System of Automatic Transplanting
Dongmei Pei,Fanjun Meng,HaiLong Wang 보안공학연구지원센터 2016 International Journal of Multimedia and Ubiquitous Vol.11 No.7
As a kind of modern technology of growing seedling, Tray seedling is efficient with little plant diseases and insect pests, and save labors, which make it develop rapidly in domestic. When growing seedlings, there are not only holes that are not germinant or missed, but also inferior seedlings, which lead to leakage of planting and empty of planting during follow-up mechanized transplanting. In order to utilize each area of holes and seedbeds, holes without seedlings need to be transplanted filling the gaps with seedlings. The paper introduces research of visual inspection of tray seedling and the system of automatic transplanting domestic and overseas, explores the research progress of automatic transplanting system from four aspects, which are technic of visual inspection, end effector, control system and route optimization. The paper proposes existing problems and development of domestic visual inspection and automatic transplanting system, which offers references for follow-up study and marketing application.
Pei Dongmei,Meng Fanjun,Wang HaiLong 보안공학연구지원센터 2015 International Journal of u- and e- Service, Scienc Vol.8 No.8
In order to reduce the data storage and improve data compression ratio of the stiffness matrix of 3D finite element, after analyzed the relationship between nonzero submatrix and generalized adjacent nodes of the stiffness matrix, this paper proposes an improved stiffness matrix compression algorithm, which combined negative sign compressed sparse line and a rider to store binary classification method. Then the improved algorithm is applied to the storage of the stiffness matrix of 3D-FEM. Through experimental simulation, the results show that this method saves a lot of storage space to ensure the validity of data for finite element analysis.
Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012
Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6
In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...