Alternative Multiplicative Iterative Method for Projection Matrix Design in Compressive Images

Tian Shujuan,Fan Xiaoping,Xie Jingxiong,Li Zhetao,Choi Youngjune,Sekiya Hiroo 보안공학연구지원센터 2016 International Journal of Signal Processing, Image Vol.9 No.9

Orthogonal-Gradient Measurement Matrix Construction Algorithm

Pan, Tian,Choi, Youngjune,Tian, Shujuan,Fan, Xiaoping,Li, Zhetao,Sekiya, Hiroo Institution of Electrical Engineers 2016 Chinese journal of electronics Vol.25 No.1

<P>An orthogonal-gradient measurement matrix construction algorithm is proposed for reducing the maximum and average mutual-coherence of sensing matrix. It shrinks Gram matrix based on equiangular tight frame theory. An orthogonal-gradient factor matrix is deduced. It obtains an optimized measurement matrix with the orthogonal-gradient factor matrix. The results of experiments show that the proposed algorithm effectively reduces the maximum and average mutual-coherence of sensing matrix. This leads to a better reconstruction performance for signals with different sparsities compared with Gaussian matrix, Elad's, Xu's, Vahid's and Li's methods.</P>

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...

Microwave-assisted pyrolysis of phosphoric acid-activated Goldenberry peel powder biochar for enhancing the adsorption of trace beta-lactamase inhibitors

Tian Ai,Chunmei Xu,Lei Zhang,Ke Chen,Yonggui Wu,Shujuan Dai,Xiaolu Xiong,Shixin Jie,Xiaoni Jin,Zhongxu Yu 한국화학공학회 2022 Korean Journal of Chemical Engineering Vol.39 No.9

Novel efficient biochar of Goldenberry peels (GBPMW-H3PO4) was prepared through a microwave-assistedphosphoric acid activation method. It was characterized and used for removing two beta-lactamase inhibitors, sulbactam(SAM, first listed in Japan in 1986) and avibactam (AVI, first listed in the U.S. in 2015), from aqueous solution. Characterization confirmed that GBPMW-H3PO4 displayed a high surface area (720.046m2 g1), more abundant porestructure, smaller particle size, and higher thermal stability. The experimental results showed that the adsorption of thetwo antibiotics was a spontaneous, favorable, and endothermic process, highly dependent on solution pH. A contacttime of 60 min assured equilibrium, and GBPMW-H3PO4 followed pseudo-first-order kinetics (R2=0.9950-0.9977). Furthermore,the adsorption capacities of GBPMW-H3PO4 for SAM and AVI were 211.86 and 198.81mg g1, respectively,and the performance was better than that of unmodified biochar. Microscopically, the main mechanism could beexplained by - electron donor-acceptor interaction, hydrogen bonding interaction, -hydrogen bonding, hydrophobicinteraction, and electrostatic interaction. The study demonstrates that the microwave-assisted H3PO4 activationmethod could produce biochar, and GBPMW-H3PO4 was confirmed to be a low-cost and high-efficiency adsorbent forremoving beta-lactamase inhibitors from medical wastewater.

Distributed cooperative communication nodes control and optimization reliability for resource-constrained WSNs

Liu, Xiao,Liu, Anfeng,Li, Zhetao,Tian, Shujuan,Choi, Young-june,Sekiya, Hiroo,Li, Jie Elsevier 2017 Neurocomputing Vol.270 No.-

<P><B>Abstract</B></P> <P>The utilization of distributed control and optimization is still a challenge issue to achieve reliable communication for resource-constrained networked systems. In this paper, a distributed cooperative communication nodes control (DCCNC) approach is proposed to achieve higher reliability communication and longer network lifetime for resource-constrained wireless sensor network (WSNs). A DCCNC scheme adopts feedback control approach to determine the appropriate number of node which participates in cooperative communication according to the application reliability requirements. A residue energy notification mechanism is used to notice the minimum residual energy of nodes in a network, then the number of cooperative communication nodes is adjusted according to the difference between the residual energy of nodes and the minimum residual energy of network. In a DCCNC scheme, larger number of participate cooperative communication nodes are adopted in non-hotspots area to achieve high reliability, while less number of participate cooperative communication nodes are adopted in hotspots area to achieve high network lifetime. The theoretical analysis and experimental results show that comparing with previous communications schemes, DCCNC scheme can reduce end to end Data Fail delivering Ratio (DFR) by 57.16–93.29% while retaining network lifetime, and DCCNC approach can also improves lifetime by 3.89–18.75% while retaining weighted end to end (DFR).</P>

Metastatic pattern of ovarian cancer delineated by tracing the evolution of mitochondrial DNA mutations

Xu Zhiyang,Zhou Kaixiang,Wang Zhenni,Liu Yang,Wang Xingguo,Gao Tian,Xie Fanfan,Yuan Qing,Gu Xiwen,Liu Shujuan,Xing Jinliang 생화학분자생물학회 2023 Experimental and molecular medicine Vol.55 No.-

Ovarian cancer (OC) is the most lethal gynecologic tumor and is characterized by a high rate of metastasis. Challenges in accurately delineating the metastatic pattern have greatly restricted the improvement of treatment in OC patients. An increasing number of studies have leveraged mitochondrial DNA (mtDNA) mutations as efficient lineage-tracing markers of tumor clonality. We applied multiregional sampling and high-depth mtDNA sequencing to determine the metastatic patterns in advanced-stage OC patients. Somatic mtDNA mutations were profiled from a total of 195 primary and 200 metastatic tumor tissue samples from 35 OC patients. Our results revealed remarkable sample-level and patient-level heterogeneity. In addition, distinct mtDNA mutational patterns were observed between primary and metastatic OC tissues. Further analysis identified the different mutational spectra between shared and private mutations among primary and metastatic OC tissues. Analysis of the clonality index calculated based on mtDNA mutations supported a monoclonal tumor origin in 14 of 16 patients with bilateral ovarian cancers. Notably, mtDNA-based spatial phylogenetic analysis revealed distinct patterns of OC metastasis, in which a linear metastatic pattern exhibited a low degree of mtDNA mutation heterogeneity and a short evolutionary distance, whereas a parallel metastatic pattern showed the opposite trend. Moreover, a mtDNA-based tumor evolutionary score (MTEs) related to different metastatic patterns was defined. Our data showed that patients with different MTESs responded differently to combined debulking surgery and chemotherapy. Finally, we observed that tumor-derived mtDNA mutations were more likely to be detected in ascitic fluid than in plasma samples. Our study presents an explicit view of the OC metastatic pattern, which sheds light on efficient treatment for OC patients.