Studying the Effect of Downregulating Autophagy-Related Gene LC3 on TLR3 Apoptotic Pathway Mediated by dsRNA in Hepatocellular Carcinoma Cells

Guilan Wang,Maona Zhang,Yunlong Li,Jiaming Zhou,Li Chen 대한암학회 2017 Cancer Research and Treatment Vol.49 No.1

Purpose The purpose of this study is to examine the role of the double-stranded RNA (dsRNA) activated Toll–interleukin-1 receptor domain-containing adaptor inducing interferon  (TRIF) signal pathway in triggering apoptosis in hepatocellular carcinoma (HCC) cells. Materials and Methods First, siRNA targeted autophagy–related gene LC3 (pU6H1-LC3 siRNA and siLC3) and a dsRNA used as a Toll-like receptor 3 (TLR3) ligand was constructed and synthesized, respectively. Then, a human HCC cell line was transfected with dsRNA, siLC3, and cotransfected with siLC3 and dsRNA (siLC3+dsRNA), respectively. Finally, quantification real-time polymerase chain reaction, western blotting, and immunofluorescence staining were used in the HCC line (SMMC7721), and MTT assay, flow cytometry, terminal deoxynucleotidyl transferase-mediated dUTP nick-end-labeling, and transmission electron microscopy were used in an HCC xenograft model of nude mice. Human umbilical vein endothelial cell tube forming assay, color Doppler ultrasonographic flow image examination, and CD34-positive microvessel density were used in vitro and in vivo. Results Compared with untreated cells, the protein and mRNA expression of TLR3 and TRIF was up-regulated, in order, siLC3+dsRNA, dsRNA, and siLC3. Expression of LC3 was obviously down-regulated and the autophagosomes were significantly decreased in siLC3+dsRNA and siLC3, whereas in dsRNA (p < 0.05). LC3 and TRIF colocation was observed in HepG2 cells. Decreased cell viability, increased apoptosis, decrease in xenograft tumor volume, and angiogenesis potential were also observed in order (p < 0.05). Conclusion Suppression of intracellular autophagy resulted in decreased degradation of TRIF protein, which can promote triggering of apoptosis by the TLR3-TRIF pathway. dsRNA and siLC3 could play anticancer roles in coordination.

Effect of a Bacterial Laccase on the Quality and Micro-Structure of Whole Wheat Bread

Wang Jingjing,Bai Han,Zhang Ran,Ding Guoao,Cai Xuran,Wang Wei,Zhu Guilan,Zhou Peng,Zhang Yan 한국미생물·생명공학회 2023 Journal of microbiology and biotechnology Vol.33 No.12

The gluten protein content in whole-wheat flour is low, which affects the elasticity and viscosity of the dough. Enzymatic modification of the protein may result in a network that mimics gluten, which plays an important role in the processing of whole-wheat foods. In this study, the effects of Halomonas alkaliantartica laccase (LacHa) on the quality parameters of whole-wheat bread were investigated. The optimum dosage of LacHa was 4 U/100 g of whole-wheat flour. At this dosage, whole-wheat bread exhibited the best specific volume and optimum texture parameters. Laccase also extended the storage duration of whole-wheat bread. We analyzed the micro-structure of the dough to determine its gluten-free protein extractable rate and free sulfhydryl group content, and verify that LacHa mediates cross-linking of gluten-free proteins. The results demonstrated that the cross-linking of gluten-free protein by LacHa improves the texture of whole-wheat bread. As a flour improver, LacHa has great developmental and application potential in baked-food production.

Identification of quantitative trait loci associated with drought tolerance traits in rice (Oryza sativa L.) under PEG and field drought stress

Han, Bing,Wang, Jiao,Li, Yafei,Ma, Xiaoding,Jo, Sumin,Cui, Di,Wang, Yanjie,Park, Dongsoo,Song, Youchun,Cao, Guilan,Wang, Xingsheng,Sun, Jianchang,Shin, Dongjin,Han, Longzhi Springer Netherlands 2018 Euphytica Vol.214 No.4

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...

The Feasibility of Using Biomarkers Derived from Circulating Tumor DNA Sequencing as Predictive Classifiers in Patients with Small-Cell Lung Cancer

Yu Feng,Yutao Liu,Mingming Yuan,Guilan Dong,Hongxia Zhang,Tongmei Zhang,Lianpeng Chang,Xuefeng Xia,Lifeng Li,Haohua Zhu,Puyuan Xing,Hongyu Wang,Yuankai Shi,Zhijie Wang,Xingsheng Hu 대한암학회 2022 Cancer Research and Treatment Vol.54 No.3

Purpose To investigate the feasibility of biomarkers based on dynamic circulating tumor DNA (ctDNA) to classify small cell lung cancer (SCLC) into different subtypes. Materials and Methods Tumor and longitudinal plasma ctDNA samples were analyzed by next-generation sequencing of 1,021 genes. PyClone was used to infer the molecular tumor burden index (mTBI). Pre-treatment tumor tissues [T1] and serial plasma samples were collected (pre-treatment [B1], after two [B2], six [B3] cycles of chemotherapy and at progression [B4]). Results Overall concordance between T1 and B1 sequencing (n=30) was 66.5%, and 89.5% in the gene of <i>RB1</i>. A classification method was designed according to the changes of <i>RB1</i> mutation, named as subtype Ⅰ (both positive at B1 and B2), subtype Ⅱ (positive at B1 but negative at B2), and subtype Ⅲ (both negative at B1 and B2). The median progressive-free survival for subtype Ⅰ patients (4.5 months [95%CI: 2.6-5.8]) was inferior to subtype Ⅱ (not reached, p<0.0001) and subtype Ⅲ (10.8 months [95%CI: 6.0-14.4], p=0.002). The median overall survival for subtype Ⅰ patients (16.3 months [95%CI: 5.3-22.9]) was inferior to subtype Ⅱ (not reached, p=0.01) and subtype Ⅲ (not reached, p=0.02). Patients with a mTBI dropped to zero at B2 had longer median overall survival (not reached vs. 19.5 months, p=0.01). The changes of mTBI from B4 to B1 were sensitive to predict new metastases, with a sensitivity of 100% and a specificity of 85.7%. Conclusion Monitoring ctDNA based <i>RB1</i> mutation and mTBI provided a feasible tool to predict the prognosis of SCLC.