On Modified Second-order Sliding Mode Synchronization of Two Different Fractional Order Hyperchaotic Systems

Xiaomin Tian,Shumin Fei,Lin Chai 보안공학연구지원센터 2015 International Journal of Multimedia and Ubiquitous Vol.10 No.4

A modified second-order sliding mode (SOSM) control scheme is developed to synchronize two different fractional order hyperchaotic systems. On the basis of chattering free SOSM control scheme, a special fractional sliding mode surface is firstly proposed. Subsequently, a robust control law is designed to ensure the occurrence of sliding mode in a given time. This control scheme is rigorously proved by Lyapunov stability theory. Finally, a numerical example is given to illustrate the effectiveness of the proposed synchronization approach.

Robust Stabilization of a Class of Uncertain Fractional-order Chaotic Systems via a Novel Sliding Mode Control Scheme

Xiaomin Tian,Shumin Fei,Lin Chai 보안공학연구지원센터 2014 International Journal of Hybrid Information Techno Vol.7 No.6

This paper proposes a novel sliding mode control (SMC) scheme to stabilize a class of fractional-order chaotic systems. Through constructing two sliding mode variables, the control problem of n-dimensional system can be transformed to the equivalent stabilizing problem of a reduced-order system. Subsequently, on the basis of second-order sliding mode (SOSM) technique, a robust control law is designed, which strongly attenuates the chattering phenomenon inherent in traditional sliding mode controller, and guarantees the existence of sliding motion in a finite time. The stability of two sliding mode variables to the origin is proved by conventional and fractional Lyapunov theories, respectively. Finally, two numerical examples are provided to illustrate the effectiveness of the proposed approach.

Striking Dispersion of Recrystallized Poly(ethylene glycol)-Poly(lactic acid) Solvent-Casting Blend

Xiaomin Zhu,Ran Huang,Tian Zhong,Ajun Wan 한국고분자학회 2015 폴리머 Vol.39 No.6

The solvent casted poly(ethylene glycol) (PEG) and poly(lactic acid) (PLA) blend was recrystallized by the thermal treatment of a heating and cooling cycle. The high PEG content blend (30 wt%) showed a striking dispersion behavior, that the materials rapidly dispersed and dissolved in the aqueous environment in a few hours. This phenomenon has not been reported by others, and was not observed in low PEG content samples of 5%, 10%, and 20%, or quenched(amorphous) samples. We hypothesized the mechanism that the chain rearrangement during the thermal treatment leads to the phase separation. And with the phase separation in the recrystallized samples, the PEG potions rapidly dissolved in the aqueous environment, left out the small PLA spherulites being separated and dispersed in the solution. The same underlying reason can also be inferred from the degradation behaviors of other samples. Characterizations of DSC, XRD, and SEM have been done to validate our hypothesis.

Atomistic simulations of nanocrystalline U0.5Th0.5O2 solid solution under uniaxial tension

Hongxing Xiao,Xiaomin Wang,CHONGSHENG LONG,Xiaofeng Tian,Hui Wang 한국원자력학회 2017 Nuclear Engineering and Technology Vol.49 No.8

Molecular dynamics simulations were performed to investigate the uniaxial tensile properties of nanocrystalline U0.5Th0.5O2 solid solution with the Borne-Mayere-Huggins potential. The results indicated that the elastic modulus increased linearly with the density relative to a single crystal, but decreased with increasing temperature. The simulated nanocrystalline U0.5Th0.5O2 exhibited a breakdown in the HallePetch relation with mean grain size varying from 3.0 nm to 18.0 nm. Moreover, the elastic modulus of U1-yThyO2 solid solutions with different content of thorium at 300 K was also studied and the results accorded well with the experimental data available in the literature. In addition, the fracture mode of nanocrystalline U0.5Th0.5O2 was inclined to be ductile because the fracture behavior was preceded by some moderate amount of plastic deformation, which is different from what has been seen earlier in simulations of pure UO2.

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...

Raman Lidar for the Measurement of Temperature, Water Vapor, and Aerosol in Beijing in the Winter of 2014

Min Tan,Zhen Shang,Chenbo Xie,Hui Ma,Qian Deng,Xiaomin Tian,Peng Zhuang,Zhanye Zhang,Yingjian Wang 한국광학회 2018 Current Optics and Photonics Vol.2 No.1

To measure atmospheric temperature, water vapor, and aerosol simultaneously, an efficient multi-function Raman lidar using an ultraviolet-wavelength laser has been developed. A high-performance spectroscopic box that utilizes multicavity interference filters, mounted sequentially at small angles of incidence, is used to separate the lidar return signals at different wavelengths, and to extract the signals with high efficiency. The external experiments are carried out for simultaneous detection of atmospheric temperature, water vapor, and aerosol extinction coefficient in Beijing, under clear and hazy weather conditions. The vertical profiles of temperature, water vapor, and aerosol extinction coefficient are analyzed. The results show that for an integration time of 5 min and laser energy of 200 mJ, the mean deviation between measurements obtained by lidar and radiosonde is small, and the overall trend is similar. The statistical temperature error for nighttime is below 1 K up to a height of 6.2 km under clear weather conditions, and up to a height of 2.5 km under slightly hazy weather conditions, with 5 min of observation time. An effective range for simultaneous detection of temperature and water vapor of up to 10 km is achieved. The temperature-inversion layer is found in the low troposphere. Continuous observations verify the reliability of Raman lidar to achieve real-time measurement of atmospheric parameters in the troposphere.