http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
A Robust Optimization Method Utilizing the Variance Decomposition Method for Electromagnetic Devices
Shujuan Wang,Qiuyang Li,Jinbao Chen 한국자기학회 2014 Journal of Magnetics Vol.19 No.4
Uncertainties in loads, materials and manufacturing quality must be considered during electromagnetic devices design. This paper presents an effective methodology for robust optimization design based on the variance decomposition in order to keep higher accuracy of the robustness prediction. Sobol’ theory is employed to estimate the response variance under some specific tolerance in design variables. Then, an optimal design is obtained by adding a criterion of response variance upon typical optimization problems as a constraint of the optimization. The main contribution of this paper is that the proposed method applies the variance decomposition to obtain a more accurate variance of the response, as well save the computational cost. The performance and robustness of the proposed algorithms are investigated through a numerical experiment with both an analytic function and the TEAM 22 problem.
Life cycle emissions of greenhouse gas for ammonia scrubbing technology
Shujuan Wang,Fang Liu,Changhe Chen,Xuchang Xu 한국화학공학회 2007 Korean Journal of Chemical Engineering Vol.24 No.3
is thought that the CO2 emissions from coal-fired power plants contribute greatly to the total anthropo-genic CO2 emissions. Ammonia solvent can be used to absorb the CO2, caled amonia scrubbing. However, as hasbeen pointed out, the production of ammonia would emit CO2; therefore, the efectiveness of amonia scrubbing isdoubted. The paper focuses on the problem. Two systems are defined in the paper. System I is CO2 absorption by am-2 emissions of the twosystems are calculated by means of life cycle asessment. The paper shows that the total CO2 emissions of ammoniascrubbing are less than that of the industrial production of fertilizer ammonium bicarbonate. It can be concluded thatammonia scrubbing is an effective way to reduce the anthropogenic CO2 emissions.
Zhen Zhou,Zhichao Wu,Zhiwei Wang,Shujuan Tang,Guowei Gu,Luochun Wang,Yingjun Wang,Zhiling Xin 한국화학공학회 2011 Korean Journal of Chemical Engineering Vol.28 No.5
As a modified configuration of the conventional anaerobic/anoxic/aerobic (AAO) process, a novel anoxic/anaerobic/aerobic (Reversed AAO, RAAO) process has been extensively applied in domestic wastewater treatment plants (WWTP). In this study, the Activated Sludge Model No. 2d (ASM2d) and a secondary clarifier model were calibrated and applied to simulate a pilot-scale RAAO test and evaluate the operational performance of the RAAO process. For calibration of the biological model ASM2d, only four kinetic parameters were adjusted to accurately simulate in-process variations of ammonium, nitrate and phosphate. Simulation results by the calibrated model demonstrated that phosphorus accumulating organisms (PAO) in the RAAO process (0.243 gP·(gCOD)^−1) contains less poly-phosphate than the AAO process (0.266 gP·(gCOD)^−1). With the increasing mixed liquor recirculation ratio in the RAAO process,the fraction of heterotrophic biomass and autotrophic biomass both increased, whereas the PAO decreased owing to adverse effects of electron acceptors on phosphorus release and poly-hydroxy-alkanoates synthesis.
Ting Chen,Ming Yang,Hui Yang,Ruining Wang,Shujuan Wang,Hang Zhang,Xiaoyu Zhang,Zhijuan Zhao,Jinben Wang 한국공업화학회 2019 Journal of Industrial and Engineering Chemistry Vol.69 No.-
Although nano “green” coatings with excellent corrosion resistance have attracted great attention, the inhibition efficiency is still limited due to the lack of knowledge about the correlation between molecular structure and anticorrosion performance. Here, we fabricated a series of 3,4-dihydroxy-l-phenylalanine adlayers on self-assembled monolayers (SAMs) with varying end groups. We found that both NH2 and CF3SAMs were more conducive to the adsorption of DOPA and a flat adsorption conformation was preferentially adopted, with the plane of the phenylene ring parallel to the surface via cation-π interactions or hydrophobic interactions, leading to a compact and dense adlayer. Such DOPA-SAM multilayers can effectively protect the substrate from corrosion by suppressing the diffusion of aggressive water and acid molecules as well as the electrodissolution of metals. The lowest corrosion current of adlayers reaches 6.96 μA cm−2 which is much lower than that of bare substrate and other anticorrosion surfaces reported previously. The results provide guidance on the design of green anticorrosion materials via selecting SAMs that bridge organic and metal interface.
Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012
Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6
In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...
Research progress of triazine flame retardants
Jingsong Wang,Shouwu Yu,Shujuan Xiao 한국고분자학회 2023 Macromolecular Research Vol.31 No.4
With the concept of environmental protection deeply rooted in the hearts of the people, people pay more attention to the development of environmentally friendly flame retardants. Triazine flame retardants, which are environmentally friendly, have good compatibility with polymer matrix and strong molecular designability, have attracted extensive attention. In this paper, the general strategies for synthesizing small molecule triazine flame retardants, linear triazine flame retardants and hyperbranched triazine flame retardants are introduced, and the synthesis principle and application effect are emphasized. The development direction of triazine-based flame retardants in the future is also prospected.
Dynamic Changes of Transcriptome and Metabolites During Ripening of Alpinia Oxyphylla Fruit (AOF)
Pan Kun,Yu Xiaodan,Wang Shujuan,Hou Jie,Luo Yuchao,Gao Bingmiao 한국식물학회 2022 Journal of Plant Biology Vol.65 No.6
Alpinia oxyphylla (Yizhi) is an economically valuable plant, not only used as edible fruit, but also as an important traditional medicinal material. However, there are few studies on fruit development and metabolic pathways. To elucidate the dynamic changes of metabolites and transcription levels during fruit development of A. oxyphylla, the four parts of A. oxyphylla fruit from different periods, including early fruit (EF), middle fruit (MF), late pericarp (LP) and late seed (LS) were collected. KEGG pathway analysis shows that DEGs in EF, MF, LP are involved in amino sugar and nucleotide sugar metabolism, starch and sucrose metabolism, and plant hormone signal transduction. However, at the late part of fruit development (LS), most of the DEGs between LS and LP were enriched in pyruvate metabolism, glycolysis/gluconeogenesis, tryptophan metabolism. We found that in the early and middle parts of fruit development (EF, MF), many differential metabolites were enriched in piperidine tropane and biosynthesis of secondary metabolites, pyridine alkaloid biosynthesis. In addition, important active components, such as nootkatone in A. oxyphylla fruits accumulated in the LS part, but did not show significant differences in the first three parts. Some key transcription factors that are significantly positively correlated with the maturation of AOF have also been identified. Together, our research provides new insights into the accumulation of metabolites and the dynamic changes of the transcriptome during fruit development.
Xu Zhiyang,Zhou Kaixiang,Wang Zhenni,Liu Yang,Wang Xingguo,Gao Tian,Xie Fanfan,Yuan Qing,Gu Xiwen,Liu Shujuan,Xing Jinliang 생화학분자생물학회 2023 Experimental and molecular medicine Vol.55 No.-
Ovarian cancer (OC) is the most lethal gynecologic tumor and is characterized by a high rate of metastasis. Challenges in accurately delineating the metastatic pattern have greatly restricted the improvement of treatment in OC patients. An increasing number of studies have leveraged mitochondrial DNA (mtDNA) mutations as efficient lineage-tracing markers of tumor clonality. We applied multiregional sampling and high-depth mtDNA sequencing to determine the metastatic patterns in advanced-stage OC patients. Somatic mtDNA mutations were profiled from a total of 195 primary and 200 metastatic tumor tissue samples from 35 OC patients. Our results revealed remarkable sample-level and patient-level heterogeneity. In addition, distinct mtDNA mutational patterns were observed between primary and metastatic OC tissues. Further analysis identified the different mutational spectra between shared and private mutations among primary and metastatic OC tissues. Analysis of the clonality index calculated based on mtDNA mutations supported a monoclonal tumor origin in 14 of 16 patients with bilateral ovarian cancers. Notably, mtDNA-based spatial phylogenetic analysis revealed distinct patterns of OC metastasis, in which a linear metastatic pattern exhibited a low degree of mtDNA mutation heterogeneity and a short evolutionary distance, whereas a parallel metastatic pattern showed the opposite trend. Moreover, a mtDNA-based tumor evolutionary score (MTEs) related to different metastatic patterns was defined. Our data showed that patients with different MTESs responded differently to combined debulking surgery and chemotherapy. Finally, we observed that tumor-derived mtDNA mutations were more likely to be detected in ascitic fluid than in plasma samples. Our study presents an explicit view of the OC metastatic pattern, which sheds light on efficient treatment for OC patients.
Li, Huaiyong,Pu, Xipeng,Yao, Shujuan,Wang, Xiaoqing,Noh, Hyeon Mi,Jeong, Jung Hyun American Scientific Publishers 2016 Journal of nanoscience and nanotechnology Vol.16 No.4
<P>Y6MoO12 doped with Eu3+ was synthesized using a citrate-complexation route, and was calcined at 800 degrees C and 1400 degrees C, respectively. The structure, morphology and photoluminescence (PL) properties of the samples, and their dependence on the crystallite size were investigated. XRD patterns indicate that the Y6MoO12:Eu3+ powder was obtained at both calcination temperatures, and had a cubic structure. The results also suggest that Y6MoO12:Eu3+ calcined at 800 degrees C was in the nanocrystalline phase, which was confirmed by the SEM microimage. The crystalline size was about 140 nm. Both phosphors could be excited via three channels: f-f excitation of Eu3+ by blue light, MoO groups excitation by near-UV light, and charge transfer state excitation of Eu3+ by UV light. Both samples yielded red light emissions dominated by the D-5(0)-F-7(2) transition at 613 nm. The excitation efficient of the three channels depended on the calcination temperature. The energy transfer from the MoO groups to the Eu3+ ions was more effective in the nanocrystalline phase. The temporal decay feature of the phosphor was also characterized.</P>