http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
실리콘 잉곳 절삭시 발생하는 폐 PEG 색도 개선에 관한 연구
조윤경 ( Yun Kyeong Cho ),정경열 ( Kyeong Youl Jung ),심민석 ( Min Seok Sim ),이기호 ( Gi Ho Lee ) 한국화학공학회 2012 Korean Chemical Engineering Research(HWAHAK KONGHA Vol.50 No.2
The chromaticity of polyethylene glycol (PEG) generated from the recyling of a silicone slurry waste was improved by using activated carbon powder and a carbon filter. The color change of the PEG waste was investigated by changing the amount of adsorbent, adsorption time and temperature. The surface area of activated carbon did not have a significant impact on improving the color of the PEG waste. According to the results for the APHA color variation of the PEG waste changing the amount of the carbon adsorbent, the optimal usage to achieve the low APHA value was 100~150 mg-C/g-PEG. From the investigatnion on the effect of the adsorption temperature range from 25˚C to 100˚C, it was found that the optimal temperatures were 40~50˚C in terms of achieving the lowest APHA value. The variation of the APHA color was investigated by changing the operation condition of the activated carbon filters. The use of ACF was a good way to enhance the chromaticity of the PEG waste. As a result, the APHA value of the PEG waste (APHA= 53 at the initial waste) was reduced to be 10 through the ACF purification. It was also confirmed that the performance of the used carbon adsorbent can be recovered by the washing with purified water.
증례 : 혈관 내 초음파 후퇴 중 발생한 스텐트 변형을 성공적으로 시술한 1예
조현옥 ( Hyun Ok Cho ),조윤경 ( Yun Kyeong Cho ),윤혁준 ( Hyuck Jun Yoon ),김형섭 ( Hyung Seop Kim ),남창욱 ( Chang Wook Nam ),허승호 ( Seung Ho Hur ),김권배 ( Kwon Bae Kim ) 대한내과학회 2013 대한내과학회지 Vol.84 No.2
관상동맥 중재술을 하는 과정에서의 혈관 내 초음파의 역할이 중요해지면서 그 이용빈도 또한 높아졌고 따라서 이의 사용에 따른 합병증도 간간이 보고되고 있다. 저자들은 스텐트를 좌전하행지에 삽입한 이후 그 부착 정도를 파악하고자 혈관 내 초음파를 시행하였고 이를 혈관으로부터 제거하는 과정에서 발생한 스텐트의 변형을 새로운 혈관 내 초음파를 통하여 확인하고 여기에 또 하나의 스텐트를 추가 삽입함으로써 좋은 결과를 얻었기에 이를 보고하는 바이다. Entrapment of an intravascular ultrasound (IVUS) catheter during coronary intervention is rare, but can cause serious complications. Retrieval of an entrapped catheter can also lead to adverse results for implanted stents. We report a case in which the sheath tip at the guidewire exit port was entrapped and caused stent distortion during a post-stent IVUS procedure with automatic pullback. (Korean J Med 2013;84:274-278)
데이터 이산화와 러프 근사화 기술에 기반한 중요 임상검사항목의 추출방법: 담낭 및 담석증 질환의 감별진단에의 응용
손창식,김민수,서석태,조윤경,김윤년,Son, Chang-Sik,Kim, Min-Soo,Seo, Suk-Tae,Cho, Yun-Kyeong,Kim, Yoon-Nyun 대한의용생체공학회 2011 의공학회지 Vol.32 No.2
The selection of meaningful clinical tests and its reference values from a high-dimensional clinical data with imbalanced class distribution, one class is represented by a large number of examples while the other is represented by only a few, is an important issue for differential diagnosis between similar diseases, but difficult. For this purpose, this study introduces methods based on the concepts of both discernibility matrix and function in rough set theory (RST) with two discretization approaches, equal width and frequency discretization. Here these discretization approaches are used to define the reference values for clinical tests, and the discernibility matrix and function are used to extract a subset of significant clinical tests from the translated nominal attribute values. To show its applicability in the differential diagnosis problem, we have applied it to extract the significant clinical tests and its reference values between normal (N = 351) and abnormal group (N = 101) with either cholecystitis or cholelithiasis disease. In addition, we investigated not only the selected significant clinical tests and the variations of its reference values, but also the average predictive accuracies on four evaluation criteria, i.e., accuracy, sensitivity, specificity, and geometric mean, during l0-fold cross validation. From the experimental results, we confirmed that two discretization approaches based rough set approximation methods with relative frequency give better results than those with absolute frequency, in the evaluation criteria (i.e., average geometric mean). Thus it shows that the prediction model using relative frequency can be used effectively in classification and prediction problems of the clinical data with imbalanced class distribution.
심인성쇼크로 관상동맥 중재술 중 대동맥 내 풍선펌프 사용 시 임상 경과
이재필 ( Jae Pil Lee ),남창욱 ( Chang Wook Nam ),박정호 ( Jung Ho Park ),배종엽 ( Jong Yop Bae ),김인철 ( In Cheol Kim ),조윤경 ( Yun Kyeong Cho ),박형섭 ( Hyoung Sub Park ),윤혁준 ( Hyuck Jun Yoon ),김형섭 ( Hyungseop Kim ),허승 대한내과학회 2015 대한내과학회지 Vol.89 No.2
Background/Aims: The mortality of hospitalized patients undergoing treatment with an intra-aortic balloon pump (IABP) due to cardiogenic shock is well known as quite high. The aim of this study was to evaluate the outcome of percutaneous coronary intervention (PCI) with an IABP in patients with acute coronary syndrome (ACS) and cardiogenic shock and identify the predictors of in-hospital mortality. Methods: 134 patients who underwent PCI with IABP due to ACS complicated by cardiogenic shock were consecutively enrolled. Outcomes were obtained and analyzed during hospitalization and after 1 year. Results: The incidence of all-cause mortality was 35.8% (in-hospital mortality, 34.3%, 1-year mortality, 1.5%). The nonsurvival group exhibited higher peak levels of creatine kinase MB, lower ejection fractions, and higher incidences of ST elevation myocardial infarction, ventricular arrhythmia, and use of an assistive device than did the survival group. Aging (hazard ratio 2.839, 95% confidence interval 1.408-5.723, p = 0.004), the use of a temporary pacemaker (2.035, 1.114-3.720, 0.021), the use of a mechanical ventilator (4.376, 1.852-10.341, 0.001), and the performance of cardiopulmonary resuscitation (CPR) (2.219, 1.017-4.839, 0.045) were independent predictors for in-hospital mortality. However, out-of-hospital mortality among in-hospital survivors was not affected by predictors of in-hospital mortality. Conclusions: The incidence of in-hospital mortality was high, as expected in patients undergoing PCI with IABP due to ACS with cardiogenic shock. Aging, CPR, and additional procedures such as pacemaker use and mechanical ventilation were predictors of in-hospital mortality. However, the patients who were successfully discharged after the complex procedure showed acceptable 1-year outcomes. (Korean J Med 2015,89:186-191)
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
10 년간 경상의대 의학과 학생의 A 형 간염 항체 양성률 변화와 경상의대 소아과 근무 의료인의 항체 양성률
임재영,고경혁,조명제,이시은,조중현,윤희상,백승철,이우곤,이광호,우향옥,조윤경,박찬후,정양숙,이수진 대한소화기학회 1999 대한소화기학회지 Vol.33 No.4
Background/Aims: Korean population has been suggested to be minimally exposed to hepatitis A virus (HAV) for recent 20 years. Therefore, hepatitis A epidemics may occur among medical students and medical personnels who care the asymptomatic patients with hepatitis A. We investigated the changes in anti-HAV IgG positive rate among the medical students for 10 years and the curren anti-HAV IgG positive rate among the medical personnels in Chinju. Methods: Serum anti-HAV IgG was measured using the commercially available HAVAB radioimmunoassay kit. The sera had been collected from 780 sophomore medical students during 1988-1997 and from 95 pediatric medical personnels at the Gyeongsang National University Hospital in December, 1997. Results: The anti-HAV IgG positive rate of the sophomore medical students was 87.5% in 1988, 86.7% in 1989 83.8% in 1990, 75% in 1991, 85% in 1992, 70% in 1993, 56.3% in 1994, 58.8% in 1995, 53.8% in 1996 and 38.8% in 1997. The anti-HAV IgG positive rate among the pediatric medical personnel (mean age ±S.D.; 26.4 ±3.1) was 65.3%. Conclusions: These suggest that the population susceptible to HAV exists among medical students and pediatric medical personnels. Therefore, we should se up the preventive modalities against hepatitis A virus infection among these high risk groups.