http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
- 中文 을 입력하시려면 zhongwen을 입력하시고 space를누르시면됩니다.
- 北京 을 입력하시려면 beijing을 입력하시고 space를 누르시면 됩니다.
RISS 인기검색어
- 검색키워드
- 저자 : 최명범(Myung-Bum Choi) (검색결과 2 건)
- 무료
- 기관 내 무료
- 유료
-
한주영(Joo-Young Han),박슬기(Seul-Ki Park),최명범(Myung-Bum Choi),이부형(Boo-Hyung Lee) 한국정보기술학회 2019 Proceedings of KIIT Conference Vol.2019 No.6
본 논문에서는 동물은 물론 식물까지 포함한 반려생물의 일상을 기록 공유할 수 있으며, 반려인들의 커뮤티티를 활성화하고 반려생물에 관한 상품을 교환하거나 구매할 수 있는 SNS를 구현하였다. UI구현은 포토샵, 안드로이드스튜디오, 자바라이브러리을 이용하였으며, 기능구현은 OS는 Oreo, 플랫폼은 Node.js, 언어는 Java, JavaScript 및 kotlin, 데이터베이스는 MySQl을 Server로는 Spring을 사용하여 구현하였다. 제안된 시스템은 기존의 강아지나 고양이이외 다양한 동물은 물론, 조류, 파충류등이 포함되며 식물까지 포함하여 전반적인 반려생물에 대한 정보를 공유할 수 있어 반려인들 간에 정서적인 공감대 및 안정갑을 심어줄 수 있고 커뮤니티의 활성화, 반려생물에 대한 시장의 활성화를 이루 수 있다는 장점을 갖는다.
-
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
연관 검색어 추천
이 검색어로 많이 본 자료
활용도 높은 자료
