A Study on the Development and Trend of the Condominium Apartment Plan in Suzhou, China

Cui Erfei,Jiang Lili,Byungsook Choi 한국주거학회 2015 한국주거학회 국제학술대회논문집 Vol.2015 No.4

Sulforaphane Ameliorates Diabetes-Induced Renal Fibrosis through Epigenetic Up-Regulation of BMP-7

Lili Kong,Hongyue Wang,Chenhao Li,Huiyan Cheng,Yan Cui,Li Liu,Ying Zhao 대한당뇨병학회 2021 Diabetes and Metabolism Journal Vol.45 No.6

Background: The dietary agent sulforaphane (SFN) has been reported to reduce diabetes-induced renal fibrosis, as well as inhibit histone deacetylase (HDAC) activity. Bone morphologic protein 7 (BMP-7) has been shown to reduce renal fibrosis induced by transforming growth factor-beta1. The aim of this study was to investigate the epigenetic effect of SFN on BMP-7 expression in diabetes-induced renal fibrosis.Methods: Streptozotocin (STZ)-induced diabetic mice and age-matched controls were subcutaneously injected with SFN or vehicle for 4 months to measure the in vivo effects of SFN on the kidneys. The human renal proximal tubular (HK11) cell line was used to mimic diabetic conditions in vitro. HK11 cells were transfected to over-express HDAC2 and treated with high glucose/palmitate (HG/Pal) to explore the epigenetic modulation of BMP-7 in SFN-mediated protection against HG/Pal-induced renal fibrosis.Results: SFN significantly attenuated diabetes-induced renal fibrosis in vivo. Among all of the HDACs we detected, HDAC2 activity was markedly elevated in the STZ-induced diabetic kidneys and HG/Pal-treated HK11 cells. SFN inhibited the diabetes-induced increase in HDAC2 activity which was associated with histone acetylation and transcriptional activation of the BMP-7 promoter. HDAC2 over-expression reduced BMP-7 expression and abolished the SFN-mediated protection against HG/Pal-induced fibrosis in vitro.Conclusion: Our study demonstrates that the HDAC inhibitor SFN protects against diabetes-induced renal fibrosis through epigenetic up-regulation of BMP-7.

Facile preparation of antifouling g-C3N4/Ag3PO4 nanocomposite photocatalytic polyvinylidene fluoride membranes for effective removal of rhodamine B

Yanhua Cui,Lili Yang,Minjia Meng,Qi Zhang,Binrong Li,Yilin Wu,Yunlei Zhang,Jihui Lang,Chunxiang Li 한국화학공학회 2019 Korean Journal of Chemical Engineering Vol.36 No.2

A simplified strategy for facilely fabricating antifouling graphite carbon nitride/silver phosphate (g-C3N4/ Ag3PO4) nanocomposite photocatalytic polyvinylidene fluoride (PVDF) porous membranes was developed for effective removal of rhodamine B (RhB). g-C3N4/Ag3PO4 heterojunction was strongly fixed to the interior of the PVDF membranes via phase inversion method. The membrane structure was analyzed by Fourier transform spectrophotometer (FT-IR). The morphology of the prepared membranes was investigated using scanning electron microscopy (SEM), EDX-mapping and atomic force microscopy (AFM), respectively. All prepared nanocomposite photocatalytic PVDF membranes exhibited a typically porous structure, and g-C3N4/Ag3PO4 nanocomposites were well dispersed inside the membranes. The obtained g-C3N4/Ag3PO4 heterojunction nanoparticle decorated PVDF membrane had a lower water contact angle of 79o and higher porosity of 85% than that of other two control membranes. The nanocomposite photocatalytic PVDF porous membranes had extremely high permeation flux over 1,083 L·m−2·h−1, and could be used for the removal of RhB. The removal efficiency of g-C3N4/Ag3PO4-PVDF membranes towards RhB solution under visible light irradiation reached 97%, higher than that of the pure PVDF membranes (41%) and g-C3N4-PVDF membranes (85%). Remarkably, the flux performance and flux recovery ratio (FRR) of membranes revealed that the g-C3N4/Ag3PO4- PVDF membranes could recover high flux after fouling, which presented better fouling resistance. Furthermore, the fabricated antifouling g-C3N4/Ag3PO4 nanocomposite photocatalytic PVDF porous membranes exhibited excellent recyclability. Therefore, it is expected that g-C3N4/Ag3PO4-PVDF membranes could provide an energy-saving strategy for effective removal of organic dyes wastewater and have a great potential for practical wastewater treatment in the future.

Nature-mimicking fabrication of antifouling photocatalytic membrane based on Ti/BiOI and polydopamine for synergistically enhanced photocatalytic degradation of tetracycline

Yanhua Cui,Lili Yang,Yan Yan,Zengkai Wang,Jian Zheng,Binrong Li,Yonghai Feng,Chunxiang Li,Minjia Meng 한국화학공학회 2021 Korean Journal of Chemical Engineering Vol.38 No.2

The photocatalytic efficiency of conventional blending photocatalytic membranes suffers a significant reduction due to effective photocatalyst embedded in membrane matrix. Therefore, in this study, inspired by the bioadhesive technology of polydopamine (pDA), a novel Ti doped bismuth oxyiodide (BiOI)-polydopamine (pDA)-coated cellulose acetate (CA) (Ti/BiOI-pDA/CA) photocatalytic nanocomposite membranes were successfully developed for effective removal of tetracycline (TC). The Ti/BiOI-pDA/CA nanocomposite membranes displayed very high photocatalytic activity toward TC (about 98% after 120 min) under visible light irradiation and superior photodegradation kinetics (k=0.03214 min1). The removal rate of Ti/BiOI/-pDA/CA nanocomposite membranes under dynamic cyclic degradation system could be further improved, giving TC removal efficiency of 91% in 60min. Remarkably, the permeate flux, flux recovery ratio (FRR), reversible fouling (Rr), irreversible fouling (Rir) and the total fouling ratio (Rt) revealed the Ti/BiOI-pDA/CA nanocomposite membranes had excellent antifouling performance. In addition, the Ti/ BiOI-pDA/CA nanocomposite membranes exhibited excellent stability and reusability. Therefore, this work gives insight into the effective removal of TC wastewater and has a great potential for new generation of high-performance photocatalytic membranes for practical wastewater treatment in the future.

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...

Effects of the content 4,4'-diaminodiphenyl methane on thermomechanical properties of shape-memory epoxy polymers

Kaixiao Cui,Guancheng Jiang,Guoshuai Wang,Lili Yang,Xiulun Shen 한국화학공학회 2021 Korean Journal of Chemical Engineering Vol.38 No.8

A series of thermosetting shape memory epoxy polymers (SMEPs) were prepared using the epoxy resin diglycidyl ether bisphenol A E-51 with varying content of curing agent 4,4'-diaminodiphenyl methane (DDM). The chemical, thermal and mechanical properties of the SMEPs were systematically investigated via Fourier transform infrared spectroscopy, differential scanning calorimetry, dynamic and static mechanical analysis, and thermogravimetric analysis. The results indicate that the shape-memory temperature (Tg) of the SMEPs varies within the range of 33.9 oC to 140.0 oC with DDM content increasing from 12% to 25%, and the Tg values exhibit a good linear correlation, with a correlation coefficient of more than 0.999. This indicates that SMEPs with tunable shape-memory temperatures can be realized by controlling the content of the curing agent. When the DDM content is 17-19%, the shape fixity and shape recovery ratio of the SMEPs reaches approximately 100%. In addition, the shape recovery time decreases as temperature increases. This work also highlights the effect of DDM curing agent content on the thermal, mechanical and shape-memory properties of SMEPs, and it is in favor of extending their further applications.

Simultaneous removal of Pb(II) and chemical oxygen demand from aqueous solution using immobilized microorganisms on polyurethane foam carrier

Zhengfang Ye,Lili Cui,Qingqiang Meng,Haitao Bi,Lincheng Zhou 한국화학공학회 2013 Korean Journal of Chemical Engineering Vol.30 No.9

We studied the simultaneous removal of Pb(II) and chemical oxygen demand (COD) from synthetic solutions using immobilized microorganism. The immobilized microorganisms on polyurethane foam (IPUF) were successfully prepared by cultivating the microbe B350 in a mixture of culture medium and polyurethane foam (PUF). The adsorption of Pb(II) ion from aqueous solutions onto PUF and IPUF was studied by batch adsorption. IPUF exhibited high Pb(II) removal efficiency. When 0.12 g of IPUF was used to treat 50mL of 20mg/L P(II) solution at pH 7.0 and 25 oC for 120 mins, the removal ratio was 80%. The biosorption kinetics could be described by the pseudo-secondorder model, and the adsorption isotherms could be described by Langmuir and Freundlich equations. In addition, for synthetic wastewater containing Pb(II) and C6H12O6, the removal ratios of Pb(II) and COD after being treated by IPUF for 8 hours were 92.0% and 84.2%, respectively. The removal ratio of COD clearly decreased with the increase of Pb(II)concentration, meaning that Pb(II) was toxic to the mobilized microorganisms and lower Pb(II) concentration was preferred.

Optimization of recombinant Zea mays transglutaminase production and its influence on the functional properties of yogurt

Hongbo Li,Yanhua Cui,Lanwei Zhang,Lili Zhang,Hui Liu,Jinghua Yu 한국식품과학회 2017 Food Science and Biotechnology Vol.26 No.3

The requirements for the production of optimized Zea mays transglutaminase (TGZo) using Pichia pastoris GS115 (pPIC9K-tgzo) were optimized in this study. Plackett–Burman design was used to screen variables that significantly influence TGZo production. Oleic acid, methanol, and loading volume were identified as the most significant parameters. Central composite design was employed to determine the optimal level of these three parameters for TGZo production. Results showed that 1078 mU/mL of TGZo activity and 7.6 mg/L of TGZo production were obtained under conditions of 0.07% oleic acid, 1.31% methanol, and 7.36% loading volume. To explore the functional characteristics of TGZo, it was used in yogurt. It was found that the addition of TGZo could produce yogurt with stronger acid gel and higher consistency, cohesiveness, index of viscosity, and apparent viscosity than the untreated product. Therefore, TGZo can be used as a substitute for microbial transglutaminase in the yogurt, even in the food industry.

Studies about Housing Problems Perceived by Residents in Traditional Houses in Suzhou, China

최이비,최병숙,장리리,Cui, Erfei,Choi, Byungsook,Jiang, Lili The Korean Housing Association 2014 한국주거학회 논문집 Vol.25 No.6

This study is to explore the housing problems and environment conditions perceived by residents in traditional houses in Suzhou, China. The empirical data is based on a questionnaire survey, which were from 100 residents in traditional area in Gusu area of Suzhou. In order to understand the traditional houses, on-the-spot investigation and literature review methods are adapted in this study. The main findings are as follows. Firstly, most of residents are middle-aged or older people, and their income is not high. Secondly, there are almost no cases of organizing independent workroom and storage room in their housing. Moreover, the main problems are mildew, theft, rats and cockroaches, etc. Finally, the satisfaction with the internal housing environment was appeared reasonable, but the external environment is unsatisfactory. Therefore, the external environment should be more considered in the Chinese traditional housing policy.

Effect of Angiotensin II Type I Receptor A1166C Polymorphism on Benazepril Action in Hypertensive Patients: A Family-based Association Test Study

Ning Zhang,Huadong Cui,Lili Yang 대한약학회 2012 Archives of Pharmacal Research Vol.35 No.10

Background: Few studies have examined the effect of the angiotensin II type I receptor (AT1R) A1166C polymorphism on the antihypertensive effect of the angiotensin-converting-enzyme inhibitor benazepril in patients with hypertension, and no such studies have performed analysis using the Family-Based Association Test (FBAT), The aim of our study was to examine the association between AT1R A1166C gene polymorphism and the antihypertensive effect of benazepril using the FBAT. Methods and Results: A total of 864 patients (aged, 26-62 years) with essential hypertension were identified in an epidemiological survey and enrolled in this study. Blood pressure (BP) was measured before and after 16 days of treatment with benazepril (10 mg/day). The association between the A1166C gene polymorphism and the antihypertensive effect of benazepril was assessed by FBAT. The frequencies of alleles A and C were 95.1% and 4.9%, respectively. FBAT analysis revealed that the C allele was significantly associated with high baseline diastolic BP (Z = 2.041, p = 0.041), decreased systolic BP after treatment (Z = 2.549, p = 0.011), and decreased diastolic BP after treatment (Z = 2.320, p = 0.020). Conclusion: Our results, determined using the FBAT, are the first evidence that the AT1R A1166C polymorphism may increase the antihypertensive effect of benazepril in patients with hypertension.