RISS 학술연구정보서비스

검색
다국어 입력

http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.

변환된 중국어를 복사하여 사용하시면 됩니다.

예시)
  • 中文 을 입력하시려면 zhongwen을 입력하시고 space를누르시면됩니다.
  • 北京 을 입력하시려면 beijing을 입력하시고 space를 누르시면 됩니다.
닫기
    인기검색어 순위 펼치기

    RISS 인기검색어

      검색결과 좁혀 보기

      • 좁혀본 항목

      • 좁혀본 항목 보기순서

        • 원문유무
        • 음성지원유무
        • 원문제공처
        • 등재정보
        • 학술지명
        • 주제분류
        • 발행연도
        • 작성언어
        • 저자

      오늘 본 자료

      • 오늘 본 자료가 없습니다.
      더보기
      • 무료
      • 기관 내 무료
      • 유료
      • 자기저항센서를 이용한 페라이트와 네오디뮴 자석의 특성분석

        임대영(Dae-Young Lim), 유영재(Young-Jae Ryoo), 김의선(Eui-Sun Kim), 임영철(Young-Cheol Lim), 목재균(Jai-Kyun Mok), 장세기(Se-Ky Chang) 한국지능시스템학회 2004 한국지능시스템학회 학술발표 논문집 Vol.14 No.2

        본 논문에서는 자기저항 센서를 이용하여 자율주행 시스템에서 필요로 하는 자석의 종류에 따른 자계의 특성을 분석하였다. 분석결과 거리에 따라 자계의 특성이 변화하고, 자석에 근접할수록 자계의 변화가 급격하게 나타난다. 센서가 자석에서 멀어질 수록 지자계의 값에 가까워진다. 또한 페라이트자석 보다 네오디뮴 자석의 자계특성이 우수함을 보였다.

      • 기계번역 효율 향상을 위한 한국어 구문분석의 테이블 파싱 알고리듬

        임희경(Hee-Kyung Lim), 김영우(Young_Oo Kim), 임철빈(Cheol-Bin Lim), 정상수(Sang-Soo Cheong), 최영희(Young-Hee Choi), 정영순(Young-Sun Jung), 이승우(Seung-Woo Lee), 고대경(Dai-Kyung Go), 임인철(In-Chil Lim) 한국정보과학회 1994 한국정보과학회 학술발표논문집 Vol.21 No.1

        본 논문은 기계번역의 효율을 향상시키기 위해서 한국어 구문분석을 위한 새로운 테이블 파싱 알고리듬 및 기계 번역 처리 과정에 있어서 시제와 서법을 고려치 않고 번역하므로써 발생하는 오류를 해결하기 위한 활용어 어미 테이블을 구성하여 시제와 서법처리의 효율적인 알고리듬을 제안한다. 입력된 문장은 형태소 분석부를 거쳐 출력된 각 리스트의 속성값이 두개의 큐와 스택에 저장되며, 문법규칙 테이블을 이용하여 규칙에 맞는 패턴으로 파싱한다. 본 논문에서 제안하는 알고리듬은 문장분류의 정확성을 높이고 문장성분테이블과 각 어미테이블에 의미정보를 두어 구문구조 규칙만으로 해결 할 수 없었던 다의성 및 애매성을 해결한다.

      • KCI등재
      • KCI등재
      • SCOPUSKCI등재

        Variation in Carotenoid Composition in Carrots during Storage and Cooking

        Lim,,Chae-Jin,Kim,,Hyun-Young,Lee,,Cheol-Ho,Kim,,Yong-Ung,Back,,Kyong-Whan,Bae,,Jung-Myung,Lee,,Shin-Woo,Ahn,,Mi-Jeong The Korean Society of Food Science and Nutrition 2009 Preventive Nutrition and Food Science Vol.14 No.3

        High-performance liquid chromatography (HPLC) was applied to determine the carotenoid composition of carrots during storage and cooking. Analyses were conducted immediately after harvest and 1, 2, 4, and 8 weeks after harvest. During the course of the storage, the carotenoid levels generally decreased, and this decrease was found to be greater during the first week for $\beta$-carotene (all-trans-$\beta$-carotene) and lutein, and during the second week for $\alpha$-carotene. Additionally, the amount of the $\alpha-$ and $\beta$-carotenes in carrot leaves changed slightly within the first 2 weeks of harvest when stored at $4^{\circ}C$. Specifically, the level of lutein, the main component of carrot leaves, increased from 233.8$\pm$11.7 to $346.2\pm26.7{\mu}g$/g DW during the first 2 weeks. In addition, the change in carotenoid contents was observed during the home-processing of one Korean cultivar. Carrots fried in oil showed the highest amount of $\beta$-carotene ($164.3\pm6.6{\mu}g$/g DW) and $\alpha$-carotene ($50.1\pm0.4{\mu}g$/g DW), while carrots that were prepared by sauteing, pressure-cooking in water and microwaving had the second highest levels. The greatest loss of in carotenoids occurred in response to boiling in water containing 1% NaCl, braising and baking. The content of lutein increased slightly after boiling in water containing 1% NaCl ($9.3\pm0.4{\mu}g$/g DW), while a loss in lutein occurred after preparation using other home-processing methods. A cis-isomer of all-trans-$\beta$-carotene, 13-cis-$\beta$-carotene, was present in detectable amounts in all processed samples, but not in raw roots. Another isomer, 9-cis-$\beta$-carotene, was detected in carrots that were prepared by boiling, frying and pressure-cooking.

      • KCI등재

        A Case Report on the Risk of Enterobacteriaceae Infection in the Oral and Maxillofacial Region

        Lim,,Lee-Rang,Lee,,Young-Cheol,Lee,,Hye-Jung,Jung,,Gyeo-Woon,Yun,,Na-Ra,Seo,,Yo-Seob,Oh,,Ji-Su,You,,Jae-Seek The Korean Academy of Orofacial Pain and Oral Medi 2019 Journal of Oral Medicine and Pain Vol.44 No.3

        Osteomyelitis is an inflammatory condition of the bone caused by pathogenic bacteria. The causative pathogen is usually oral residing bacteria, but this is a report of patients with osteomyelitis infected with Enterobacteriaceae, which is not common. Enterobacteriaceae has been known to cause in-hospital infections for over last 30 years and is known to have multiple antibiotic resistances. Both cases in this study developed osteomyelitis after removal of the dentigerous cyst. Enterobacter aerogenes was cultured in one patient and Serratia marcescens in the other. After changing antibiotics through antibiotic susceptibility testing, clinical symptoms subsided and radiographic images confirmed that the callus formed and recovered at the same time.

      • OP-124 : Application of tumor kinetics for evaluation of hyperprogression in immune checkpoint inhibitor treatment for non-small cell lung cancer

        ( Cheol-kyu Park ), ( Joon-young Yoon ), ( Ji-eun Kim ), ( Min-seok Kim ), ( Bo-geon Koh ), ( Ha-young Park ), ( Tae-ok Kim ), ( Hong-joon Shin ), ( Yong-soo Kwon ), ( In-jae Oh ), ( Yu-il Kim ), ( Sung-chul Lim) 대한결핵 및 호흡기학회 2019 대한결핵 및 호흡기학회 추계학술대회 초록집 Vol.127 No.-

        Background: Existing criteria for response assessment (RECIST v1.1) have limitations in differentiating categories of disease progression upon immune checkpoint inhibitor (ICI) treatment: primary resistance, pseudoprogression or hyperprogression (HPD). This study was aimed to investigate a real-world feasibility of pre- and on-treatment tumor kinetics for ICIs-specific response assessment in NSCLC. Methods: We retrospectively recruited stage III/IV NSCLC patients treated with anti-PD-1/PD-L1 monotherapy after failure of first-line platinum-doublet chemotherapy (n=91) between June 2016 and October 2018. We analyzed tumor kinetics prior and upon ICI treatment using ratio of tumor growth rate (TGR ratio, TGRR), tumor growth kinetics (TGK ratio, TGK<sub>R</sub>) and difference in TGR (delta TGR, ΔTGR), respectively. HPD was defined as TGRR ≥2, TGK<sub>R</sub> ≥2 and ΔTGR >50%. Results: After excluding 18 patients without CT scan after start of ICIs, 73 patients were enrolled. Overall response rate by RECIST v1.1 was 16.4% (12/73) and disease control rate was 62% (45/73). HPD patients was 12% (9/73) and 15% (11/73) when defined by TGRR and TGK<sub>R</sub>, respectively. There was no HPD patients defined by ΔTGR. HPD patients classified by each criterion were associated with shorter median progression-free survival (PFS) according to iRECIST (TGRR ≥2, 1.6 vs 2.1 months, p<0.001; TGK<sub>R</sub> ≥2, 1.6 vs 2.1 months, p<0.001) and median overall survival (OS) than non-HPD-PD patients (TGRR ≥2, 2.4 vs 5.2 months, p=0.002; TGK<sub>R</sub> ≥2, 2.4 vs 5.2 months, p=0.002). There was no pseudoprogression in patients classified as HPD. Conclusion: HPD defined by pre- and on-treatment tumor kinetics was observed in 12-15% of patients with advanced NSCLC treated with second-line ICI monotherapy, and correlated with shorter PFS and OS. TGR and TGK could classify HPD patients from non-HPD PD with similar discriminability. Further studies are needed to investigate clinical and molecular determinants that distinguish HPD from non-HPD PD and pseuoprogression.

      • Contribution of Bulk Flow to Transport Mechanisms of the Membranes Surrounding Amniotic Fluid in the Rabbit

        Lim,,Young-Cheol,Lee,,Sang-Jin,Sung,,Ho-Kyung The Korean Physiological Society 1994 대한생리학회지 Vol.28 No.1

        '스콜라' 이용 시 소속기관이 구독 중이 아닌 경우, 오후 4시부터 익일 오전 7시까지 원문보기가 가능합니다.

        The objective of the present study is to assess the contribution of bulk flow to the regulatory mechanism of amniotic fluid volume and its ionic concentration in the membranes surrounding the amniotic fluid. For quantitative assessment, we prepared 4 kinds of artificial amniotic fIuids (isotonic isovolumetric, hypotonic isovolumetric, isotonic hypervolumetric and hypotonic hypervolumetric ones) by replacing 70% of amniotic fluid of pregnant rabbits with water or normal Tyrode solutions. Isoosmotic saline of 0.5 ml volume containing 0.05% Censored and 15 mM/l LiCl was administered initially into amniotic sacs of all subject animals. Samples of amniotic fluid were collected in after 30 and 90 minute intervals; the concentrations of Censored, $Na^+\;and\;Li^+$ were determined and compared. Followings are the results obtained. 1. from isovolumetric and increased Congcord group, we couldn't find significant change in $Li^+\;and\;Na^+$ concentration in isotonic amniotic fluid. However, $Na^+$ concentration increased significantly as well as a striking increase in Censored concentration in hypotonic amniotic fluid. 2. In isovoIumetric and decreased Censored group, the rate of $[Li^+]$ decrement and the rate of $[Na^+]$ increment were much higher in hypotonic amniotic fluid than in isotonic. 3. In hypervolumetric and increased Censored group, the rate of $Na^+$ efflux increased proportionately with the increment of Censored concentration up to 0.98, which was higher than the rate of $Li^+$ efflux in isotonic amniotic fluid. However, the increment of $Na^+$ concentration was rather related with the initial $Na^+$ concentration in hypotonic amniotic fluid, showing inverse relationship. $Li^+$ concentration increased only when there was a marked increase in Censored concentration and approached near a maximum value or 1. 4. For hypervolumetric and decreased Censored group, the observations were identical to isovolumetric and decreased Censored group. From these results the following conclusions could be made: 1) There is no net movement of water or monovalent cations across the membranes surrounding amniotic fIuid in isotonic isovolumetric condition. In contrast, there is a net efflux of amniotic fluid by osmotic bulk flow, resulting in elevation of $Na^+$ concentration in hypotonic isovolumetric condition. 2) In hypervolumetric conditions, there is a massive efflux of amniotic fluid or solvent drag through the surrounding membranes by fiItrative bulk flow, where the rate of $Na^+$ efflux has a linear relationship with that of water efflux. This is assumed to be carried out through enlarged and newly opened intercellular spaces resulting from increased intraamniotic pressure. 3) Once increasing intraamniotic pressure reaches a point allowing $Li^+$ to pass through during osmotic bulk flow in hypotonic amniotic fIuid, $Na^+$ influx seems to occur by diffusion simultaneously or immediately thereafter, too.

      • SCOPUSKCI등재

        소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계

        임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1

        Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.

      • KCI등재

        Immunohistochemical Study of O-GlcNAcylation in Human Skin Tumors

        Young Lee(이영), Dong Kyun Hong(홍동균), Dae Kyoung Choi(최대경), Seul Ki Lim(임슬기), Kyung Cheol Sohn(손경철), Myung Im(임명), Young Joon Seo(서영준), Young Ho Lee(이영호), Jeung Hoon Lee(이증훈), Chang Deok Kim(김창덕) 대한체질인류학회 2014 대한체질인류학회지 Vol.27 No.2

        단백질 전사 후 변형 (posttranslational modification)은 단백질 기능을 조절하는 기전의 하나로, 당화(gycosylation), 아세틸화 (acetylation), 메틸화 (methylation) 등을 포함한다. O-linked β-N-acetylglucosamine (OGlcNAc)에 의한 단백질 전사 후 변형은 많은 세포 반응에 관여하는 조절 기전으로 최근 연구가 많이 진행되고 있다. 특히, O-GlcNAc에 의한 단백질 전사 후 변형(O-GlcNAcylation)은 유방암, 폐암 및 대장암 등과 같은 암질환의 발병에 관여함이 보고되었다. 그러나 이러한 O-GlcNAcylation이 피부종양에 어떠한 영향을 미치는지 잘 밝혀져 있지 않다. 본 연구에서는 다양한 피부종양을 대상으로 하여 O-GlcNAcylation이 어떻게 일어나는지 면역조직화학을 통해 살펴보았다. 그 결과, 양성종양에 비해 암전구증 및 악성종양에서 전체적으로 O-GlcNAcylation이 증가해 있었다. 또한 O-GlcNAcylation을 담당하는 효소인 O-GlcNAc transferase (OGT) 및 O-GlcNAc을 제거하는 효소인 O-GlcNAcase (OGA) 발현 또한 양성종양에 비해 암전구증 및 악성종양에서 증가해 있었다. 이러한 연구 결과는 O-GlcNAcylation이 여러 피부종양의 발병에 관여함을 시사한다. O-linked β-N-acetylglucosamine modification is an important post-translational modification, emerging as a novel regulatory mechanism in various cellular events. Recently, several studies have shown that O-GlcNAcylation plays an essential role in human breast, lung, and colon cancers. With regard to skin cancers, the role of O-GlcNAcylation has yet to be elucidated. To investigate whether O-GlcNAcylation is linked to human skin tumor development, immunohistochemical analysis was performed to investigate the presence of OGlcNAcylation in various skin tumors. We evaluated the levels of O-GlcNAcylation, O-GlcNAc transferase, and O-GlcNAcase in 29 benign tumors, 12 premalignant tumors, and 26 malignant tumors in skin. Compared to the benign tumors, premalignant and malignant tumors had increased patterns of O-GlcNAcylation. In addition, the O-GlcNAc transferase and O-GlcNAcase levels were higher in premalignant and malignant tumors than in benign tumors. Interestingly, O-GlcNAcase levels were significantly increased in premalignant tumors compared to benign and malignant tumors. These results suggest that O-GlcNAcylation of proteins may play an important role in the development of human skin tumors.

      맨 위로 스크롤 이동