http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
Shi, Xinjian,Cai, Lili,Choi, Il Yong,Ma, Ming,Zhang, Kan,Zhao, Jiheng,Kim, Jung Kyu,Kim, Jong Kyu,Zheng, Xiaolin,Park, Jong Hyeok The Royal Society of Chemistry 2018 Journal of Materials Chemistry A Vol.6 No.40
<P>Charge carrier dynamics and light harvesting ability are most important for the performance of a photoanode in photoelectrochemical (PEC) systems. In this work, through a facile flame surface treatment process in a reducing atmosphere, oriented WO3 nanoneedles are grown on pre-formed vertically aligned nanohelices. Nanohelices have excellent light harvesting abilities on their own; however, the addition of nanoneedles to the top of nanohelices increases the light harvesting abilities even further. More importantly, the reducing atmosphere for the post-treatment process enhances the metallic properties of WO3, changes the band position to facilitate hole transport, and modifies the flat band potential, all of which contribute to an improved performance in terms of photocurrent density and onset. The as-fabricated WO3 nanohelices/nanoneedles with a metallic interface have also been used for heterojunction photoanode fabrication for water oxidation through two- and four-electron pathways for H2O2 and O2 production, respectively.</P>
Shi, Binghua,Su, Yixin,Zhang, Huajun,Liu, Jiawen,Wan, Lili The Society of Naval Architects of Korea 2019 International Journal of Naval Architecture and Oc Vol.11 No.1
The obstacles modeling is a fundamental and significant issue for path planning and automatic navigation of Unmanned Surface Vehicle (USV). In this study, we propose a novel obstacles modeling method based on high resolution satellite images. It involves two main steps: extraction of obstacle features and construction of convex hulls. To extract the obstacle features, a series of operations such as sea-land segmentation, obstacles details enhancement, and morphological transformations are applied. Furthermore, an efficient algorithm is proposed to mask the obstacles into convex hulls, which mainly includes the cluster analysis of obstacles area and the determination rules of edge points. Experimental results demonstrate that the models achieved by the proposed method and the manual have high similarity. As an application, the model is used to find the optimal path for USV. The study shows that the obstacles modeling method is feasible, and it can be applied to USV path planning.
General Characterization Methods for Photoelectrochemical Cells for Solar Water Splitting.
Shi, Xinjian,Cai, Lili,Ma, Ming,Zheng, Xiaolin,Park, Jong Hyeok Wiley-VCH 2015 ChemSusChem Vol.8 No.19
<P>Photoelectrochemical (PEC) water splitting is a very promising technology that converts water into clean hydrogen fuel and oxygen by using solar light. However, the characterization methods for PEC cells are diverse and a systematic introduction to characterization methods for PEC cells has rarely been attempted. Unlike most other review articles that focus mainly on the material used for the working electrodes of PEC cells, this review introduces general characterization methods for PEC cells, including their basic configurations and methods for characterizing their performance under various conditions, regardless of the materials used. Detailed experimental operation procedures with theoretical information are provided for each characterization method. The PEC research area is rapidly expanding and more researchers are beginning to devote themselves to related work. Therefore, the content of this Minireview can provide entry-level knowledge to beginners in the area of PEC, which might accelerate progress in this area.</P>
Liu, Lili,Cheng, Chongling,Liu, Hongjiang,Shi, Liyi,Wang, Dayang The Korean Powder Metallurgy Institute 2015 한국분말재료학회지 (KPMI) Vol.22 No.5
The present work reports a systematic study of using carboxymethylated cellulose (CMC) as water-borne binder to produce $Li_4Ti_5O_{12}$-based anodes for manufacture of high rate performance lithium ion batteries. When the LTO-to-CB-to-CMC mass ratio is carefully optimized to be 8:1:0.57, the special capacity of the resulting electrodes is $144mAh{\cdot}g^{-1}$ at 10 C and their capacity retention was 97.7% after 1000 cycles at 1 C and 98.5% after 500 cycles at 5 C, respectively. This rate performance is comparable or even better than that of the electrolytes produced using conventional, organic, polyvinylidene fluoride binder.
Binghua Shi,Huajun Zhang,Jiawen Liu,Lili Wan 대한조선학회 2019 International Journal of Naval Architecture and Oc Vol.11 No.1
The obstacles modeling is a fundamental and significant issue for path planning and automatic navigation of Unmanned Surface Vehicle (USV). In this study, we propose a novel obstacles modeling method based on high resolution satellite images. It involves two main steps: extraction of obstacle features and construction of convex hulls. To extract the obstacle features, a series of operations such as sea-land segmentation, obstacles details enhancement, and morphological transformations are applied. Furthermore, an efficient algorithm is proposed to mask the obstacles into convex hulls, which mainly includes the cluster analysis of obstacles area and the determination rules of edge points. Experimental results demonstrate that the models achieved by the proposed method and the manual have high similarity. As an application, the model is used to find the optimal path for USV. The study shows that the obstacles modeling method is feasible, and it can be applied to USV path planning.
Wang, Lili,Moon, Byung Kee,Park, Sung Heum,Kim, Jung Hwan,Shi, Jinsheng,Kim, Kwang Ho,Jeong, Jung Hyun The Royal Society of Chemistry 2016 NEW JOURNAL OF CHEMISTRY Vol.40 No.4
<P>Bi3+,Eu3+ doped CdWO4 phosphors have been synthesized using a co-precipitation method and regular micro-rods were obtained in Bi3+ or Eu3+ single-doped samples. X-ray diffraction, scanning electron microscopy, UV-vis spectrophotometry, and photoluminescence and decay time measurements were used to characterize the as-prepared samples. CdWO4:Bi3+ and CdWO4:Bi3+,Eu3+ can be excited ranging from 250 to 400 nm. The excitation at 350 nm was assigned to be the Bi3+ S-1(0) -> P-3(1) transition according to the energy level rules of Bi3+ ions. The origin of O-W charge transfer transition has been analyzed using the calculated band structure and density of states of CdWO4 based on density functional theory. The approach to charge compensation was two impurity ions substituting for three Cd2+ sites. Energy transfer properties from the WO6 group to Bi3+ as well as from Bi3+ to Eu3+ were discussed. The mechanism of energy transfer from Bi3+ to Eu3+ was determined to be the quadrupole-quadrupole interaction and the critical distance of energy transfer from Bi3+ to Eu3+ was calculated to be 15.31 angstrom. The quantum efficiency, CIE chromaticity and thermal quenching properties have also been investigated.</P>
Wang, Lili,Noh, Hyeon Mi,Moon, Byung Kee,Park, Sung Heum,Kim, Kwang Ho,Shi, Jinsheng,Jeong, Jung Hyun American Chemical Society 2015 The Journal of Physical Chemistry Part C Vol.119 No.27
<P>Dual-mode excitation properties were introduced in Sm<SUP>3+</SUP> doped Sr<SUB>2</SUB>CaMoO<SUB>6</SUB> prepared by a high temperature solid state reaction technique. Two ways are available to generate white light in the single-component phosphor activated by Sm<SUP>3+</SUP> ions. Warm white light can be obtained from Sr<SUB>1.995</SUB>Sm<SUB>0.005</SUB>CaMoO<SUB>6</SUB> phosphor pumped by 380 or 411 nm excitation energy. The full visible spectral emission of the single-phase phosphor comes from the high and low level emission lines of Sm<SUP>3+</SUP> ions as well as the intrinsic luminescence of MoO<SUB>6</SUB> group. It is also competitive as yellow-emitting phosphor for blue pumped white LEDs and gives three emission bands at 567, 603, and 650 nm, presenting yellow luminescence upon 466 nm radiation. The 650 nm red emission band corresponding to <SUP>4</SUP>G<SUB>5/2</SUB> → <SUP>6</SUP>H<SUB>9/2</SUB> transition of Sm<SUP>3+</SUP> can make its color rendering index better. The excellent photoluminescence of Sr<SUB>2</SUB>CaMoO<SUB>6</SUB> is related to the partial tilting CaO<SUB>6</SUB> octahedral and the lowered symmetry were confirmed by General Structure Analysis System. Band gap of Sr<SUB>2</SUB>CaMoO<SUB>6</SUB> estimated from the diffuse reflection spectra and also calculated by CASTEP mode shows its semiconducting character. All the results show that the Sr<SUB>2–<I>x</I></SUB>Sm<SUB><I>x</I></SUB>CaMoO<SUB>6</SUB> phosphors have considerable potential for applications in near UV LED or pumped by blue LED chip.</P><P><B>Graphic Abstract</B> <IMG SRC='http://pubs.acs.org/appl/literatum/publisher/achs/journals/content/jpccck/2015/jpccck.2015.119.issue-27/acs.jpcc.5b02828/production/images/medium/jp-2015-02828d_0011.gif'></P>
The Role of Intestinal Fungi and Its Metabolites in Chronic Liver Diseases
Ningning You,Lili Zhuo,Jingxin Zhou,Yu Song,Junping Shi 거트앤리버 소화기연관학회협의회 2020 Gut and Liver Vol.14 No.3
Current studies have confirmed that liver diseases are closely related to intestinal microorganisms; however, those studies have mainly concentrated on bacteria. Although the proportion of intestinal microorganisms accounted for by colonizing fungi is very small, these fungi do have a significant effect on the homeostasis of the intestinal microecosystem. In this paper, the characteristics of intestinal fungi in patients with chronic liver diseases such as alcoholic liver disease, nonalcoholic fatty liver disease and cirrhosis are summarized, and the effects of intestinal fungi and their metabolites are analyzed and discussed. It is important to realize that not only bacteria but also intestinal fungi play important roles in liver diseases.
Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012
Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6
In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...