Distribution Performance of Practice Midwives Through Entrepreneurial Leadership, Motivation, Organizational Learning and Commitment

Endang SUSWATI(Endang SUSWATI ) 한국유통과학회 2023 유통과학연구 Vol.21 No.2

Purpose: to explore more deeply the variables of knowledge construction in influencing performance, through entrepreneurial leadership, motivation, organizational learning, and commitment to the performance of midwives in providing maximum service to patients and the community. Research design, data and methodology: using quantitative methods with hypothesis testing, data was obtained through direct visits and surveys to midwife practice locations through coordination with the Indonesian Midwives Association (IBI) regarding surveys to be carried out and needed. Results: there are 3 direct paths that have significant value. The path between the motivation variable to commitment was found to be significant, then the effect of organizational learning on commitment was found to be significant and finally the effect of the path variable from commitment to distribution performance was found to be significant. The indirect effect was found to be insignificant for the influence of entrepreneurial leadership through commitment to distribution performance, but different results found a significant indirect effect for the relationship between motivation through commitment to performance and organizational learning through commitment to distribution performance. Conclusion: there is a high commitment to the work of midwives, commitment as a good mediation in influencing distribution performance between organizational learning and work motivation.

Dye Sorption and Swelling of Poly(vinyl alcohol) Hydrogels in Congo Red Aqueous Solution

Endang Katmiwati,Tadashi Nakanishi 한국고분자학회 2014 Macromolecular Research Vol.22 No.7

The swelling behavior of cylindrical poly(vinyl alcohol) (PVA) hydrogels, prepared by means of γ-rayirradiation technique with different irradiation doses have been investigated. The cylindrical gels with ca. 0.2 mmdiameter were immersed in various concentrations of Congo red (CR) solutions, and the time course of the swellingdegree of the gels were microscopically measured. The swelling degree was increased with the increase in polymercontent and time course, but decreased with increasing the irradiation dose. The sorption experiment of CR onto PVAhydrogels was also carried out. CR concentrations of the solutions before and after the sorption were determined spectrophotometrically. Higher irradiation dose of hydrogels had higher dye uptakes. This result reveals that the gels werestrongly crosslinked, and the CR anions were bound to PVA as bridges between the hydroxyl groups of PVA. Theeffect of incorporation of dye on the chemical structure of PVA hydrogels was studied by using differential scanningcalorimetry (DSC), and Fourier transform infrared (FTIR) spectroscopy. The results of DSC analysis showed thatthe melting temperatures of CR-PVA hydrogels are significantly lower than that of PVA hydrogels alone. It is possibleto conclude that PVA structure has a significant loss of crystallinity when PVA interacts with CR. FTIR spectra ofPVA hydrogels and CR-PVA hydrogels showed the absorption regions of the specific functional groups associated withhydroxyl groups of PVA confirming the formation of cross-links between them. The results showed that the interactionbetween PVA hydrogels and CR affect the swelling and sorption properties of the hydrogels.

Construction of Caries DNA Vaccine pCDNA-ComD

Endang Winiati Bachtiar,Boy M Bachtiar 대한예방치과학회 2015 International Journal of Clinical Preventive Denti Vol.11 No.3

Objective: The aim of the study is to construct anti-caries DNA vaccine harboring a main virulence genes from caries pathogen Streptococcus mutans. Methods: The gene encoding a quorum sensing molecule (ComD) was amplified from genomic DNA from S. mutans by polymerase chain reaction (PCR), using primers: ComD-F: 5’ggatccatgaatgaagccttaatgat 3’ and ComD-R: 5’ ggatcctattttattattaggagttgc 3’. Then the PCR product was digested with BamH1 and cloned into the plasmid pCDNA3.1 containing CMV promoter and ampicillin resistant gene that had been digested with the same enzyme. The plasmid was then transformed into Escherichia coli JM 2163, and plasmid DNA was subsequently isolated from this strain. Passaging of plasmid DNA via JM 2163 ensures stability of plasmid DNA. Finally the recombinant plasmid pCDNA-ComD was analyzed by DNA sequencing and for protein ComD expression from transfected HaCat cell line by Western blotting. Results: The S. mutans ComD gene was successfully cloned into the pCDNA3.1 vector and PCR confirmed that the new clone, pCDNA-ComD consists of a 1.3 kb of ComD DNA fragment. Sequence analysis of the ComD coding region in pCDNA-ComD revealed an identity match of 100% with that of ComD DNA sequences from the Gene Bank database. In addition, Western blot showed the expression of ComD protein from transfected HaCat cell line. Conclusion: We have successfully constructed anti caries DNA vaccine pCDNA-ComD.

Adventitious root culture for secondary metabolite production in medicinal plants: A Review

Endang Rahmat,Youngmin Kang 한국식물생명공학회 2019 JOURNAL OF PLANT BIOTECHNOLOGY Vol.46 No.3

Medicinal plants are high-value natural resources that have been used as precautionary drugs by many people globally. The increasing global demand for bioactive compounds from medicinal plants has led to the overexploitation of many valuable species. One widely used approach to overcome this problem is the use of adventitious root cultures as a propagation strategy. This review examines the scientific research published globally on the application of adventitious root cultures for many medicinal plants. Adventitious roots generated under aseptic environments in suitable phytohormone-augmented medium exhibit high growth rates and production of important secondary metabolites. Parameters such as medium properties and composition, growth hormone type, and elicitation strategies for in vitro grown adventitious roots of medicinal plants, are the main topics discussed in this review. We also examine current developments in bioreactor system cultivation for plant bioactive compounds using adventitious root cultures, a technology with possible commercial applications, via several studies on adventitious root culture of medicinal plants in which bioreactor systems play a role. In conclusion, the development of adventitious root cultures for medicinal plants is highly useful because of their capability for vegetative propagation and germplasm preservation.

Gastronomic ethnobiology of “terites”—a traditional Batak Karo medicinal food: A ruminant's stomach content as a human food resource

Endang C. Purba,Marina Silalahi,Nisyawati 한국식품연구원 2018 Journal of Ethnic Foods Vol.5 No.2

Background: Terites is a traditional food of Batak Karo ethnic group, which is cooked with a juice of partly digested food (chyme) of slaughtered cattle. The stomach juice serves as a soup base, cooked together with certain wild and cultivated vegetables, aromatic herbs and possibly also meat. The objectives of this ethnobiological study were to describe terites preparation, document plant species used and to discuss possible implications for the human nutrition. Methods: The data were gathered through individual interviews and group discussions with informants from 6 villages in Karo regency of North Sumatra. The plant specimens were collected in the field and identified taxonomically. Results: A total of 29 plant species belonging to 17 families were used to prepare terites. The main rationale behind consuming this indigenous food was its perceived medicinal value, particularly for the treatment of digestive disorders. Karo people use several lesser-known wild food plants for preparation of this local specialty. To best of our knowledge, consumption of chyme in tropical Asia is so far unique solely to the Batak Karo people. The present ethnographic record of consuming chyme as a medicinal food is also discussed in the context of paleodietary reconstructions. Conclusion: This extraordinary food heritage of Karo indigenous gastronomy, based on traditional knowledge, indicates rich foodscapes and bio-cultural diversity of the Batak Karo ethnic group.

COD Removal through Soil Below Landfill Site

( Endang Setyaningrum ),( Harun S. Sukamadijaya ),( E. Damanhuri ) 한국폐기물자원순환학회 2010 APLAS Vol.2010 No.0

State of the art of Indonesian agriculture and the introduction of innovation for added value of cassava

Endang Sukara,Sri Hartati,Safendrri Komara Ragamustari 한국식물생명공학회 2020 Plant biotechnology reports Vol.14 No.2

The dramatic population increase with rapid industrialization in developing countries has placed great strains on food and energy supplies. This is also the case for Indonesia. Despite having fertile volcanic soil and a strong agriculture tradition, these assets are under pressure, and strategies to preserve them from industrialization are urgently needed. Recently, the number and the interest to take on the profession of farmer have sharply declined, mainly due to urbanization. It should also be noted that the agricultural lands, both their area and fertility, have decreased. Farming has also become more challenging due to climate change. An alternative solution to revitalize the agricultural sector, increase the number of farmers, and increase their livelihood is urgently needed to ensure food security. For this reason, strengthening research activities in the fi eld of crop biotechnology to improve agriculture production, human health, and social security is required. There should be multi-stakeholder collaborative eff orts to develop reliable and environmentally sustainable approaches for agriculture. In this paper, our focus is on the application of biotechnology for cassava processing. Cassava was chosen due to it being the fourth largest staple food in the tropics and is well studied in Indonesia. In connection with improving the livelihood of cassava farmers, an introduction of bioprocess for the improvement of economic value of cassava tuber is highlighted, including an example of work for converting of cassava tuber to mycoprotein. In comparison with a commercial product, our results have shown comparable, if not better characteristics.

ORBITAL ENERGY DURING THE EVOLUTION OF THE ORBITAL DYNAMICS OF ASTEROID 4179 TOUTATIS

SOEGIARTINI, ENDANG The Korean Astronomical Society 2015 天文學論叢 Vol.30 No.2

In our previous work, we investigated the orbital dynamics of Asteroid 1934 CT (or 1989 AC or 4179 Toutatis) from epoch 2012-Jul-24 (JDE2456132.5) using the Mercury program package. Asteroid 4179 Toutatis has an Earth and Mars crossing orbit with semimajor axis a = 2.5292 AU and eccentricity e = 0.6294, and therefore the perihelion distance is q = 0.9373 AU and the aphelion distance is Q = 4.1211 AU. After more than 300,000 years, asteroid 4179 Toutatis will escape from the Solar System, but during this time, it will have close-encounters with other planets from Venus to Uranus. As a continuation of this project, we investigated its energy changes in each close encounter. We also determine the energy of this asteroid when it escapes from the Solar System. The result is that during its orbital evolution, the energy of this asteroid changes and gives us negative, zero and positive values.

The Effect of Service Quality and Product Diversity on Customer Loyalty: The Role of Customer Satisfaction and Word of Mouth

TJAHJANINGSIH, Endang,NINGSIH, Dewi Handayani Untari,UTOMO, Agus Prasetyo Korea Distribution Science Association 2020 The Journal of Asian Finance, Economics and Busine Vol.7 No.12

Batik industry is a business activity oriented towards customer loyalty and is demanded to show an increasing diversity of products with various motives designed to prevent customers from moving to other companies. Therefore, the purpose of this study is to develop a theoretical approach in solving problems in the relationship between service quality and product diversity on satisfaction and word of mouth (WoM) and its impact on customer loyalty. Furthermore, this study also examined the mediating effects of satisfaction and WoM in the relationship between service quality and product diversity on customer loyalty. This research's object took the customers of Batik Semarangan Craftwork, Indonesia, with the phenomenon of always developing creative and innovative Batik motif designs that can be accepted by the market without leaving Semarang's uniqueness. The total sample was 98 customers. The results of the study showed that service quality and product diversity positively affected satisfaction and WoM and had a positive effect on customer loyalty. Besides, satisfaction and WoM had a mediating effect on the effect of service quality and product diversity on loyalty. Thus, it is essential for management to create and increase customer loyalty by paying attention to service quality, product diversity, satisfaction, and WoM.

Adventitious root culture for secondary metabolite production in medicinal plants: A Review

Rahmat, Endang,Kang, Youngmin The Korean Society of Plant Biotechnology 2019 식물생명공학회지 Vol.46 No.3

Medicinal plants are high-value natural resources that have been used as precautionary drugs by many people globally. The increasing global demand for bioactive compounds from medicinal plants has led to the overexploitation of many valuable species. One widely used approach to overcome this problem is the use of adventitious root cultures as a propagation strategy. This review examines the scientific research published globally on the application of adventitious root cultures for many medicinal plants. Adventitious roots generated under aseptic environments in suitable phytohormone-augmented medium exhibit high growth rates and production of important secondary metabolites. Parameters such as medium properties and composition, growth hormone type, and elicitation strategies for in vitro grown adventitious roots of medicinal plants, are the main topics discussed in this review. We also examine current developments in bioreactor system cultivation for plant bioactive compounds using adventitious root cultures, a technology with possible commercial applications, via several studies on adventitious root culture of medicinal plants in which bioreactor systems play a role. In conclusion, the development of adventitious root cultures for medicinal plants is highly useful because of their capability for vegetative propagation and germplasm preservation.