학습장애와 관련된 개념, 원인, 특성, 판별에 관한 블로그 내용분석:10년 전 연구와 비교

임혜민 조선대학교 교육대학원 2018 국내석사

본 연구의 목적은 학습장애의 정의 및 개념, 원인, 특성, 판별에 관한 블로그의 내용 분석을 통해 일반인들의 인식수준의 변화를 알아보기 위한 것이다. 특히 10년 전 학습장애의 하위영역에 관한 블로그간의 비교를 통해 내용을 분석하였다. 이러한 목적을 달성하기 위해 본 연구에서는 10년 전 연구와 동일하게 내용분석 연구방법을 적용하였다. 2009년 2월부터 2017년 1월까지 블로그에 작성된 학습장애 내용을 검색한 결과 총 49개의 블로그가 검색되었다. 이 중에서 광고성, 레포트 관련 내용 및 중복되는 것을 제외한 결과 총 20개의 블로그가 분석대상으로 선정되었다. 주요 연구결과를 요약하면 다음과 같다. 첫째, 블로그에 나타난 학습장애 관련 정보는 학습장애의 개념과 특성이 가장 높은 비율을 보였다. 10년이 지난 후에도 학습장애 개념과 특성의 내용이 대부분 차지하고 있는 것이다. 둘째, 학습장애의 원인은 10년 전 연구와 같이 생물학적 요소에 높은 비율을 보였고, 유전적 요인과 환경적 요인에도 많은 언급이 있었다. 특히 10년 전 보다 환경적 요인의 증가율이 높아졌다. 또한 학습장애 학생을 치료할 수 있다는 목적으로 검증이 되지 않는 지식과 정보들이 블로그에 무분별하게 기술되어 있었다. 셋째, 판별의 경우 불일치의 접근과 중재반응 모델 접근법의 비율이 높았고, 처리과정의 결함 접근은 전혀 언급이 없었다. 판별과 관련된 문헌의 수는 다른 영역에 비해 매우 적었고 판별에 대한 정보와 지식 또한 매우 부족하였다. 결론 및 제언에서는 학습장애 관련 협회 또는 해당 전문가들이 학습장애와 관련된 지식과 정보의 접근성이 용이하도록 정확한 정보를 제공하거나 이에 대한 서비스 망을 구축할 필요성이 제기되었다. The purpose of this study was to investigate the changes in the contents of blogs about the definition, concept, causes, characteristics, and identification of students with learning disabilities. In particular, the contents were analyzed by comparing the blogs about the sub-areas of learning disabilities with those of ten years ago. To meet this study purpose, this study applied the content analysis research method as same as the study conducted ten years ago. As the results of searching the contents of learning disabilities shown in blogs from February 2009 to January 2017, a total of 49 blogs were searched. After excluding the contents related to advertising, reports, and overlapped contents, a total of 20 blogs were selected as the subjects of analysis. The results of this study could be summarized as follows. First, regarding the information related to learning disabilities shown in the blogs, the concept and characteristics of learning disabilities showed the highest percentage. Even ten years later, the concept and characteristics of learning disabilities occupied the greatest part. Second, The cause for learning disabilities showed the high percentage of biological elements just like the research ten years ago while there were also lots of comments on the genetic factor and environmental factor. Especially, compared to the research ten years ago, the increase rate of environmental factor was increased. Also, for the purpose of treating the students with learning disabilities, such unverified knowledge and information were thoughtlessly described in the blogs. Third, in case of identification, the percentage of the approach of discordance and the approach of response-to-intervention model was high while there was no mention of the processing deficit approach. The number of literature related to the identification was very few compared to other areas, and the information and knowledge about the identification were also very insufficient. The conclusions and suggestions suggested the necessity of providing the accurate information or establishing the service network, so that the associations related to learning disabilities or relevant experts could easily access the knowledge and information related to learning disabilities.

록 뮤지컬의 음악적 특징 고찰 : 조나단 라슨의 작품을 중심으로

임혜민 경희대학교 일반대학원 2018 국내석사

뮤지컬의 근원은 오페라라고 볼 수 있다. 뮤지컬의 형식과 비슷한 오페라의 첫 작품은 1728년 존 게이(John Gay)의 《거지 오페라(The Beggar‘s Opera)》이지만, 최초의 뮤지컬로 불리 우는 것은 1892년 조지 에드워드(George Edwardes)의 《거리에서(In town)》이다. 유럽에서 인기를 누리던 뮤지컬은 유럽 이주민들과 함께 미국으로 전파되었다. 150년의 역사를 통해 뮤지컬은 상업적이고 대중적인 공연 산업 분야로 자리매김을 해왔다. 그 이후 텔레비전과 록 음악의 등장으로 뮤지컬이 침체기를 경험하였고 생계에 직접적인 영향을 받으며 뮤지컬계에도 새로운 시도와 발전이 일어났다. 새로운 시도로 많은 뮤지컬들이 록 적인 요소를 음악에 가미시키며 록 뮤지컬을 만들어 내었는데 1967년 《헤어(Hair)》가 대중적으로 성공함으로써 최초의 록 뮤지컬로 소개되고 있다. 하지만 《헤어》의 작곡가 맥더모트(McDermott)가 《헤어》 이후 만든 록 뮤지컬들이 실패를 거듭하였다. 오페라 《라 보엠(La Boheme)》을 기반으로 한 록 뮤지컬 《렌트(Rent)》가 등장함으로 《헤어》 이후 브로드웨이에 젊은 관객들을 다시 불러들이는 큰 역할을 하였다. 브로드웨이에서 초연된 이래 매년 공연을 매진시키고 1966년 토니상 최우수 뮤지컬 상을 비롯해 4개 부문을 수상하고 퓰리처상 등 많은 상을 수상하였다. 《렌트》가 대중적으로 성공한 이후 조나단 라슨의 또 다른 작품 《틱틱붐(Tick Tick Boom)》이 오프브로드웨이에서 공연을 올리고 오리지널 레코딩 앨범이 흥행하며 조나단 라슨의 록 뮤지컬 계보가 이어졌다. 본 논문은 록 뮤지컬의 음악적 특징을 알아보기 위해 조나단 라슨의 작품 《렌트》, 《틱틱붐》을 중심으로 분석, 연구하여 록 뮤지컬의 음악적 특징들을 도출하였다. 요약하면 다음과 같다. 첫 번째, 도미넌트에서 서브도미넌트로 진행하는 역진행을 사용하여 블루스적인 느낌을 주었다. 두 번째, 페달 포인트를 자주 사용하였다. 세 번째, 멜로디에 도약 진행을 사용하여 샤우팅 창법으로 노래하였다. 네 번째, 8비트로 반주하는 곡에서는 전자 기타 중심으로 곡이 진행되었다. 다섯 번째, 가사에서 선정적인 단어나 비속어의 사용보다는 라임이 더 많이 사용되었다. 여섯 번째, 뮤지컬의 주제에서 사회적인 문제를 드러내어 문제에 관심을 갖게 하고 소외된 계층의 삶을 보여주어 공감할 수 있도록 하였다. 정리하면 텔레비전과 록 음악의 대중매체가 발전함으로 뮤지컬의 침체기가 찾아왔지만 뮤지컬에 록 음악을 중심적으로 사용하여 록 뮤지컬을 만들어 내었고, 록 뮤지컬 《헤어》가 성공하였다. 하지만 그 이후 다시 록 뮤지컬은 실패를 거듭하였는데 《헤어》처럼 혁명적인 뮤지컬을 만들려고 했던 조나단 라슨이 《렌트》를 대중적으로 성공시킴으로 뮤지컬의 황금기가 다시 찾아왔다. 록 뮤지컬은 사회적인 문제를 드러내어 심각성을 상기시킴으로 사회에 필요한 존재가 되었다. 사회에 긍정적인 영향을 끼치는 문화산업인 록 뮤지컬의 발전을 위하여 지속적인 연구가 이루어져야 할 것이다. The musical genre was first born in England in the 19th century, originated from the opera. The first opera similar to the form of a musical was 《The Beggar’s Opera》, produced by John Gay in 1782, but the first so-called real “musical” is 《In Town》, a production by George Edwards in 1892. The musical genre first gained popularity in Europe and was spread to the U.S. by European immigrants. For 150 years, the musical genre has been settled as a popular commercial entertainment business. However, the introduction of the television and rock music brought the slump of the musical genre but caused many new experiments and development in musicals. Many musicians newly attempted to add rock music elements to musical music to create “rock musicals,” and the first such musical is 《Hair》 in 1967, which gained great success. Mc Dermott, the composer of 《Hair》, wrote many rock musicals henceforth, but they remain as some of the worst productions in Broadway history. After that, 《Rent》, a rock musical based on the opera 《La Boheme》, brought the young audience back to musical theaters. Since its premiere on Broadway, it has sold out its performances every year and won many awards including the Tony Award for Best Musical in 1966, in four categories and a Pulitzer Prize. After the popular success of 《Rent》, Jonathan Larson's another work, 《Tick Tick Boom 》, performed on off-Broadway, made a great popularity with its original recording album and the lineage of Jonathan Larson's rock musicals go on. This thesis studies and analyzes the musical characteristics of rock musicals, centered around Jonathan Larson’s 《Rent》 and 《Tick Tick Boom》. A brief summary is as below. Firstly, the atmosphere of blues was given by using reverse control, from the Dominant to the Sub-Dominant. Secondly, pedal points are frequently used. Thirdly, the melody was sung with a shouting singing style using a takeoff. Fourthly, the song, accompanied by 8 beat, was centered by the electric guitar. Fifthly, limes were used more in lyrics than suggestive words or slang. Sixthly, the musical revealed social issues in the theme of the musical to pay attention to the problem and to show life of the underprivileged, so that people can sympathize. To summarize, the musical genre entered into a depression due to the introduction and spread of the television and rock music, but by applying this rock music to the musical, the rock musical 《Hair》 earned great success. Although many rock musicals thereafter failed to gain much success, after the performance of Jonathan Larson’s sensational production 《Rent》, the golden age of the musical returned. The musical is an essential part of our society, as it reveals the seriousness of our social problems. The rock musical has become a social necessity by revealing social problems and reminding people of their seriousness. More systematic and consistent research should be practiced for the development of rock musicals, a cultural industry that positively affects society.

1990년대 소설의 신유물론적 생태주의 연구

임혜민 이화여자대학교 대학원 2025 국내석사

This study aims to propose a reading method of interpreting contemporary novels from an ecological perspective. It analyzes novels from the 1990s, which emerged with postmodernism, through the lens of new materialistic eco-criticism. This undertaking takes significance as a turning point, as an attempt to break away from the entrenched conventional methodologies of eco-criticism, as a challenge to analyze works that haven’t been interpreted through an eco-criticism, as an effort to find out overlooked alternatives by connecting the peak of global crisis in the Anthropocene back to its starting point in the 1990s. In the site of ever-deepening context of the Anthropocene, bringing the literary discourse which circularly ends with the dichotomy of subject-other, to the very starting point, provides a useful reference point for shifting the focus of the discourse. It can be reconsidered that alternatives addressing ecological concerns had already been contemplated since the 1990s, although it may not have received that much attention. One reason for the underdeveloped eco-critical discourse lies in its lack of conceptual clarity. Every Scholar uses their own different terminological definition. Furthermore, eco-critical reading has been primarily applied to poetry rather than novel, and the methodology has been separated to three dominant approaches: Deep Ecology(Arne Dekke Næss), Social Ecology(Murray Bookchin), and Eco-Feminism. These lead to restricted productivity of literary study, and ecologism is ultimately reduced to linear naturalism or Eastern philosophy in literature. Therefore, this study aims to combine a new materialistic methodology with ecologism in accordance with the need for a methodological shift. The reason for limiting on 1990s works is that the emergence of ecological discussions in Korean literary circles is considered to have started with the publication of Green Review (녹색평론) by Kim Jong-Cheol in 1991. However, 1990s novels have largely remained underexplored within the context of eco-criticism. Even though such junctions are found in the works of authors who were active under the influence of postmodernism, this kind of approach has rarely been attempted. Because their works were primarily studied for their groundbreaking form and subject matter, the content was not thoroughly studied. Yet, these novels can actually be said to contain a strong ecological dimension, to the extent that they later became a foundation for ecological discourse in Korean literature. Deconstruction of humanity’s privileged status, explorations of human-nonhuman relationships, and transformations into plants and animals are the examples. This study focuses on non-male authors born in the 1970s And especially involving side by side Han Kang, Song Kyung-a, and Djuna is essential. Han Kang is active within the mainstream literary field, Song Kyung-a navigates both within and outside literary boundaries, and Djuna is active outside the literary circle. The three authors who created unconventional works under the influence of postmodernism were studied based on traditional writing conventions or dismissed under the label of ‘new generation authors’, or overlooked as the lack of literary value in terms of their subject matter or scope of activities. Therefore, it is critical to conduct research on these authors within a single discursive framework. A new materialistic perspective, which challenges constructs such as patriarchy, modernity, and progressivism, offers a robust framework for analyzing their works and dismantling the implicit boundaries of the literary field. First, by re-exploring Han Kang's novels, which are usually analyzed through an Eco-Feminism, this study aims to reinterpret the reasons why her characters are depicted as chronically ill, using Donna J. Haraway's concept of ‘Postmodern Immunity’. By close look at the sick character, it is likely to sever the existing sensory connection sensing to the diseased body, and in its place, acquire a new sensory awareness. Han Kang metaphorizes new sensation through vegetal imagination. By focusing on the plant-like qualities that characters with diseased bodies are pursing, it is possible to predict why the characters in the novel continually attempt to transform their senses into tentacles and desire to become ‘plants’, while also yearning for ‘light’. Song Kyung-a, known for their adherence to traditional novel techniques, has been primarily recognized for her “destructive language”. This focus has overshadowed her deeper explorations of redefining “humanity” and attempts for recording authentic history. Therefore, this study aims to seriously interpret the ecological possibilities embedded in her novel through the concept of ‘Textual Cyborg’ by N. Katherine Hayles. Foregrounding the process through which the characters in the novel become ‘Cyborgs’ and intersect with their surrounding environment (everything on Earth, including humans and non-humans) enables to explore the method of writing a multifaceted history. Lastly, Djuna’s works with the fact that lines were created outside the confines of the literary world, enable planetary thinking. Dipesh Chakrabarty’s concept of planetary thinking involves viewing the planet alongside Earth, pushing humans, who were once the center of everything, to the periphery. Djuna usually utilizes alien encounters and spatiotemporal overlaps. Djuna illustrates a postmodern, postcolonial space of free connections, aligning with Bruno Latour’s philosophy of non-modernity. Thus, interpreting the works of 1990s authors Han Kang, Song Kyung-a, and Djuna, each with their distinct characteristics, through the lens of new materialistic eco-criticism, is an attempt to properly land on a planet that has already been damaged. It becomes an important moment in seeking alternatives for trying to survive no matter what. To get out of anthropocentrism, it’s crucial to ponder why bodies that are human yet cannot be included within the human collective exist, what can be the definition of human, and how human could be defined from a planetary perspective. 본 연구는 포스트모더니즘의 흐름과 함께 등장했던 1990년대 소설을 신유물론적 생태주의의 방법론으로 독해하여, 생태주의 방법론으로 현대소설에 접근할 때 가능한 또 하나의 독법을 제시하는 것을 목적으로 한다. 이러한 작업은 굳어진 기존의 생태주의 방법론에서 벗어나 새로운 관점으로 생태주의를 독파하려는 시도로서, 생태주의로 잘 읽히지 않던 작품들을 생태주의로 분석하는 도전으로서, 지구적 위기의 정점인 인류세에서 다시 시발점인 1990년대와 연결되어 놓쳤던 대안을 찾아보려는 노력으로서 ‘전환점’이 된다는 의의를 지닌다. 지속적으로 심화되기만 하는 인류세의 현장에서 주체-타자의 이분법에 대한 성찰로만 순환적으로 귀결되는 문학장의 논의를 아예 그 출발점으로 끌어다놓는 것은 논의의 시각을 돌리는 데 좋은 참조점을 준다. 주목되지 못했을 뿐 담론을 관통하는 대안이 이미 1990년대부터 성찰되고 있었음을 재고할 수 있다. 그간 생태주의 논의가 제대로 다루어지지 못했던 이유는 생태주의 담론이 획일화되어 있는 데 반해, 학자마다 사용하는 개념적 정의가 달라 활용하는 생태주의 용어가 정치하게 정립되지 못했기 때문이다. 더불어 생태주의적 독법은 활용되더라도 소설보다는 시 분야에서 활발히 논의되어왔으며, 그 방법론이 심층생태주의, 사회생태주의, 에코페미니즘으로 삼분화되어 분석되었다. 이는 논의의 생산성을 저해하며 문학에서 생태주의를 결국 단선적인 자연주의·동양사상으로 귀결되게 하는 한계를 낳았다. 따라서 본고에서는 방법론적 선회의 필요성에 따라 생태주의에 신유물론적 방법론을 결합해보고자 한다. 대상작품을 1990년대의 작품으로 한정한 이유는, 한국문단에서 생태주의의 논의가 1991년 창간된 김종철의 <녹색평론>을 본격적인 출발점으로 삼아 이뤄졌다고 판단했기 때문이다. 그러나 1990년대 소설은 생태주의의 흐름으로 제대로 연구되지 못했다. 특히나 포스트모더니즘의 영향과 함께 활발하게 활동했던 작가들의 작품에서 그러한 접합지점이 여럿 발견됨에도 불구하고 이러한 작업은 거의 시도된 바 없다. 당대에 파격적인 형식이나 소재 등에 집중해 연구된 바람에 정작 내용적 측면에서 정치하게 다뤄지지 못했던 그들의 소설은 기실 이후 한국소설에서 생태주의의 토대가 되었다고 말할 수 있을 정도로 짙은 생태주의적 색채를 담고 있다. 가령 인간의 지위를 끌어내려 비인간과 함께 논의하거나 종내에는 식물·동물이 되어가는 모습이 이에 해당한다. 본고는 1970년대생 비남성 작가의 작품을 주요 분석 대상으로 삼는다. 그 중에서도 문단 내에서 활발히 활동했던 한강, 문단 안팎을 자유로이 넘나들었던 송경아, 문단 밖에서 활동했던 듀나를 나란히 보는 작업은 담론 안에 갇혔던 시야를 확장시키기 위해서 필수적인 작업이다. 포스트모더니즘의 영향 아래 파격적인 작품세계를 창조했던 세 작가는 전통적 글쓰기 관습을 토대로 연구되거나 ‘신세대 작가’라는 이름으로 폄하되고, 소재나 활동반경의 관점에서 문학성이 없다는 이유로 다각적으로 조명되지 못했다. 따라서 이들을 하나의 담론적 흐름 안에서 자연스럽게 연구하는 작업이 반드시 필요하다. 가부장제·근대주의·진보주의 역사관 등 인간이 만들어낸 모든 틀의 해체를 지향하는 신유물론적 생태주의의 관점은 이들을 하나의 범주 안에서 제대로 분석해보는 데 유익한 틀이 된다. 그랬을 때 보이지 않는 경계를 양산하는 문단의 경계를 허물어보는 일이 유의미해진다. 가장 먼저 주로 에코페미니즘으로 분석되는 한강의 소설들을 다시 뜯어보며 소설 속 인물들이 병든 채 등장할 수밖에 없는 이유를 도나 J. 해러웨이의 ‘포스트모던 면역’ 개념을 통해 재독하고자 한다. 병든 인물의 모습을 면밀히 분석하며 기존의 병든 몸을 그대로 감각할 때 기존의 촉수를 끊을 수 있고, 그 자리에 새로운 촉수적 감각을 획득할 수 있게 된다. 한강의 경우 새로운 감각이 식물적 상상력을 통해 은유된다. 그렇게 병든 몸을 가진 인물들이 지향하는 식물성에 주목할 때 소설 속 인물들이 어떤 연유로 자신의 감각을 촉수로 변형하면서까지 끊임없이 ‘식물’이 되려하고, ‘빛’을 욕망하는지에 대해서 짐작해볼 수 있다. 한편 전통 소설의 작법으로 소설을 쓰던 송경아가 ‘파격’의 대표격으로 평가받았던 이유는 그가 조형하는 ‘파괴적인 언어’ 때문이었다. 이에 소설이 담는 지속적으로 ‘인간’을 정의하려는 열망, 제대로 된 역사를 기록하려는 시도 등은 제대로 포착되지 못했다. 이에 송경아 소설이 담지한 생태적 가능성을 캐서린 헤일스의 ‘텍스트적 사이보그’ 개념을 경유해 제대로 독해해보고자 한다. 그랬을 때 소설 속 인물들이 ‘사이보그’가 되는 과정을 전면화하고 주변 환경(인간·비인간 등 지구 위의 모든 것)과 접합됨으로써 단일한 역사쓰기에서 벗어나 한곳에 축적되지 않는 다형적 역사를 쓰는 방법을 알아볼 수 있다. 마지막으로 듀나의 소설은 문단은 문단이라는 틀 바깥에서 이루어졌다는 사실과 더불어 ‘행성적인 사유’를 가능하게 한다. 디페시 차크라바르티가 말하는 ‘행성적 사유’는 지구와 더불어 행성을 함께 보는 것으로 모든 것의 중심이었던 ‘인간’을 중심의 바깥으로 밀어낸다. 듀나가 주로 활용하는 장치는 외계적 상상력과 시공간성의 중첩이다. 이는 브뤼노 라투르가 주창하는 ‘비근대’의 철학과 맞물리며 탈근대·탈식민적 공간에서의 자유로운 연결을 구체적으로 묘사한다. 이처럼 각각의 뚜렷한 특성을 지닌 1990년대 작가 한강, 송경아, 듀나의 소설을 신유물론적 생태주의로서 독해해보는 일은 이미 망가져버린 지구 위에 제대로 착륙하여, 어떻게든 잘 살아보기 위한 대안을 모색하는 데 중요한 전환점이 된다. 인간중심주의에서 벗어나기 위해서는 ‘인간’이지만 왜 인간의 집단 안에 포섭되지 못하는 몸이 존재하는지, ‘인간’의 정의가 무엇인지, 행성적 관점으로 ‘인간’은 어떻게 정의되는지를 먼저 치밀하게 탐색할 필요가 있다.

A. Copland의 「Piano Variations」에 관한 연구

임혜민 신라대학교 2011 국내석사

대학생의 내현적 자기애와 관계적 공격성의 관계에서 사회불안과 인지적 정서조절전략의 다중매개효과

임혜민 한남대학교 대학원 2024 국내박사

The purpose of this study is to investigate the structural relationships among covert narcissism, relational aggression, social anxiety, adaptive cognitive emotion regulation strategies, and maladaptive cognitive emotion regulation strategies in university students. To achieve this, a structural model analysis was sequentially performed by setting social anxiety and adaptive and maladaptive cognitive emotion regulation strategies as mediators in the relationship between covert narcissism and relational aggression. Phantom variables were established to verify individual mediating effects, and bootstrapping methods were used for significance testing. The subjects of this study were 590 male and female university students enrolled in four-year universities in the Daejeon and Chungnam regions. A survey was conducted using scales for covert narcissism, relational aggression, social anxiety, and cognitive emotion regulation strategies. SPSS and AMOS were utilized for the analysis, which included descriptive statistics, correlation analysis, confirmatory factor analysis, structural equation modeling, and multi-group analysis. The results of this study are as follows: First, covert narcissism was found to have a direct effect on relational aggression. Second, covert narcissism had a positive effect on both social anxiety and relational aggression. Third, maladaptive cognitive emotion regulation strategies were found to have a positive effect in the relationship between covert narcissism and relational aggression. Fourth, the effect of covert narcissism on relational aggression mediated by social anxiety and adaptive cognitive emotion regulation strategies was not significant. Lastly, the effect of covert narcissism on relational aggression mediated by social anxiety and maladaptive cognitive emotion regulation strategies was significant. In other words, covert narcissism directly influences relational aggression while also having an indirect effect mediated by social anxiety and maladaptive cognitive emotion regulation strategies. This indicates that individuals with high levels of covert narcissism are more likely to experience social anxiety and respond maladaptively to negative emotions arising from external situations, which leads to the expression of relational aggression. This study holds significance in that it provides a variety of positive coping strategies through educational interventions by instructors and counselors to prevent and reduce relational aggression. This is achieved by reducing various negative factors to help university students focus on their studies and adapt positively to school life. 본 연구의 목적은 대학생의 내현적 자기애, 관계적 공격성, 사회불안, 적응적 인지적 정서조절전략, 부적응적 인지적 정서조절전략 사이의 구조적 관계를 알아보는 데 있다. 이를 위해 내현적 자기애와 관계적 공격성의 관계에서 사회불안과 적응적·부적응적 인지적 정서조절전략을 매개변인으로 설정하여 구조모형 분석을 차례로 수행하였으며, 개별 매개효과 검증을 위해 팬텀변수를 설정하였고, 유의성 검증을 위해 부트스트래핑 방법을 활용하였다. 본 연구의 대상은 대전·충남지역 4년제 대학에 재학중인 남·여 대학생 590명이다. 이들에게 내현적 자기애 척도, 관계적 공격성 척도, 사회불안 척도, 인지적 정서조절전략 척도를 사용하여 설문조사를 실시하였다. 분석방법으로는 SPSS와 AMOS를 활용하여 기술통계, 상관분석, 확인적 요인분석, 구조방정식모형검증, 다중집단분석을 실시하였다. 본 연구의 결과는 다음과 같다. 첫째, 내현적 자기애가 관계적 공격성에 직접적인 영향을 미치는 것으로 나타났다. 둘째, 내현적 자기애가 사회불안과 관계적 공격성에 정적인 영향을 미치는 것으로 나타났다. 셋째, 내현적 자기애와 관계적 공격성의 관계에서 부적응적 인지적 정서조절전략은 정적인 영향이 있는 것으로 나타났다. 넷째, 내현적 자기애가 사회불안과 적응적 인지적 정서조절전략을 매개로 관계적 공격성에 미치는 영향은 유의하지 않은 것으로 나타났다. 마지막으로 내현적 자기애가 사회불안과 부적응적 인지적 정서조절전략을 매개로 관계적 공격성에 미치는 영향은 유의하게 나타났다. 즉 내현적 자기애는 관계적 공격성에 직접적인 영향을 미치며, 동시에 사회불안과 부적응적 인지적 정서조절전략을 매개로 간접적인 영향을 미치는 것으로 나타났다. 이는 내현적 자기애 성향이 높을수록 사회불안도 쉽게 느끼고 외부에서 경험하는 상황에 부정적인 감정을 느끼게 되면 부적응적으로 대처하여 관계적 공격성으로 표출하게 된다는 것을 알 수 있다. 본 연구는 대학생이 학업에 집중하고 적응적인 학교생활을 할 수 있도록 다양한 부정적 요인들을 감소시키고, 관계적 공격성의 예방과 감소를 위한 교수자 및 상담자의 교육적 개입을 통해 긍정적 대처전략을 다양하게 활용할 수 있는 방안을 마련했다는 점에서 의의가 있다.

Molecular characterization of the Arabidopsis PFP gene

임혜민 경희대학교 생명공학원 2003 국내석사

유치원에서 일어나는 유아들의 문제 행동 양상과 교사의 언어적 상호작용

임혜민 중앙대학교 대학원 2002 국내석사

본 연구의 목적은 유치원에서 일어나는 유아들의 문제 행동 양상과 유아들의 문제 행동에 대한 교사의 언어적 상호작용 유형을 관찰하여 분석하는 것이다. 그래서 연구자는 본 연구를 위해 유치원에서 참여관찰을 통하여 사례연구를 수행하였다. 본 연구의 대상은 서울에 위치한 C유치원의 만 5세 반인 B반 유아34명과 교사1명이었다. 연구기간은 2002년 9월 9일부터 11월 1일까지 총 20회 참여 관찰, 녹음과 교사 면담을 실시하였다. 연구자는 유치원 교실 현장에 들어가서 유아들이 문제 행동을 보일 때 유아와 교사간의 언어적 상호작용을 관찰하면서 연구 문제를 이끌어냈다. 본 연구를 통해 이끌어낸 연구문제와 결과를 정리하면 다음과 같다. 첫째, 유치원에서 일어나는 유아들의 문제 행동 양상은 어떠한가? 첫째, 또래 관계에서의 문제는 바깥놀이나 자유선택 활동 시간에 많이 일어난다. 그 중 친구와 어울리지 못하는 문제는 5세 유아이며 2학기 상황이기에 많이 나타나는 문제 행동이 아니었으며, 싸우는 행동은 교사가 보지 못하는 곳에서 주로 일어났다. 둘째, 공격적.파괴적인 행동으로는 욕하기, 때리기, 물건던지기가 있다. 욕을 하는 행동은 한 유아가 바르지 못한 언어를 사용하다보면 재미로 따라하게 되는 문제 행동이었다. 때리기나 물건던지기는 놀이 시간에 주로 일어나며 대부분 교사가 보지 못하는 장소에서 일어났다. 셋째, 규칙.질서.예의.절제의 문제 중에서 말을 함부로 하는 행동과 자신의 실수를 인정하지 않는 행동의 경우는 부정적인 표현을 잘하고, 확실한 증거를 대지 않으면 절대 자신의 잘못을 인정하지 않는 몇 몇 유아들이 주로 보이는 문제 행동이다. 거짓말은 대부분 관심을 얻기 위한 것이거나, 자신이 잘못한 행동을 숨기기 위한 것이었다. 규칙을 지키지 않는 행동은 모든 유아가 규칙을 알고 있으면서도 이를 지키지 않아 문제가 되는 것으로 몇 몇 유아들이 자주 보이는 문제 행동이었다. 넷째, 위험한 행동은 실외에서 미끄럼을 탈 때 위험하게 타는 경우와 실내에서는 의자를 가지고 흔들면서 앉아 있다가 넘어지는 경우 또는 이동할 때 뛰어다니거나 슬라이딩하는 행동 등이었다. 마지막으로 집단 활동을 방해하는 행동으로는 인사하기, 이야기나누기, 새 놀이 소개, 귀가지도 등 집단 활동시간에 유아들이 옆 친구와 떠들거나 장난하는 행동 그리고 엉뚱한 행동을 보이며 방해하는 행동이었다. 교실에서 흔히 일어날 수 있는 행동으로 크게 문제가 되는 행동은 아니었지만 교사들이 어려워하는 문제 중 하나이다. 둘째, 유아들의 문제 행동이 나타날 때 교사는 유아와 어떤 언어적 상호작용을 하는가? 유아들의 문제 행동이 나타날 때 교사와 유아의 언어적 상호작용을 분석한 결과 바깥에서 유아들과 일대 일로 상호작용 할 때 교사는 유아의 감정을 더 수용하고 칭찬이나 격려를 사용하며 질문을 하고, 유아들의 대답을 요약하거나 바꾸어 말해주고, 교사의 감정을 솔직히 이야기하는 등의 언어를 많이 사용하였다. 그러나 집단 활동을 방해하거나, 분명히 알고 있는 규칙을 어겼을 경우, 그리고 그러한 행동에 대해 교사가 여러 번 주의를 주었는데도 문제 행동이 지속적인 경우에는 교사가 설명하고, 유아의 잘못된 행동을 지적하고 인식시키며 바르게 행동하도록 지시하는 등의 약간 강한 어조의 언어적 상호작용을 많이 보이는 경향이 있었다.

담배식물에서 Cop I 복합체 subunit 유전자의 분자적 기능 연구

임혜민 연세대학교 대학원 2010 국내석사

Mammalian에서 Interphase기간에는 retrograde trafficking에 관여하고, mitotic phase 중 전기 (prophase)에서 핵막붕괴 (Nuclear envelope breakdown)에 관여하는 CopⅠ복합체 subunit 유전자를 담배식물인 Nicotiana benthamiana에서 knockdown 시켜 동물에서의 연구와 같이 식물에서도 이중 기능을 갖고 있는지 분석하고자 하였다. 이 연구는 바이러스 유도 유전자 침묵 (VIGS ; Virus-Induced Gene Silencing)의 기법을 이용하였다. VIGS를 통해 CopⅠ subunit들의 silencing을 유도하여 각각의 VIGS 표현형을 관찰하였다. CopⅠ은 alpha, beta, beta-prime, gamma, delta, epsilon, zeta 등 7개의 subunits으로 구성된 soluble한 단백질 복합체 (protein complex)이며, coatomer라 불리기도 한다. 이들 중 beta-prime, gamma, delta subunit 세 유전자들 각각 knockdown 된 결과, 새롭게 자란 잎들은 매우 작아 cell size가 줄어들고, 잎 표면이 주름지며, abaxial epidermis를 Propidium Iodide로 염색한 결과, 공변세포의 여러 발달과정 중 초기 단계에서 발달이 저해된 비정상적인 공변세포 (stomata)가 많이 발견되었고, 엽록체와 미토콘드리아의 수가 감소하였다. 반면, 식물의 생장저해에 따른 활성산소의 양이 크게 증가하였다. 이러한 모든 영향은 결국 세포사멸 (cell death)로 연결되어 식물체가 빨리 죽게 된다. NbCopⅠ subunit의 Delta full gene에 형광단백질을 fusion 시켜 원형질체에서의 세포 내 위치 (subcellular localization)를 확인하는 실험 결과, Golgi에 위치한 것을 확인하였다. 또한 BiFC를 통해 단백질간의 상호 결합을 확인 해 본 결과, 각각 subunit들끼리 서로 결합한다는 사실을 확인하였고, 이것은 Golgi에 위치하는 패턴과 일치하였다. 이는 이들 유전자를 knockdown 시켰을 때, VIGS line의 TEM 사진에서 Golgi의 defect과 상호 관련이 있음을 나타내고 있다. 동물세포의 경우, CopⅠ의 결핍은 알츠하이머, 헌팅턴, 파킨스와 같은 여러 종류의 신경퇴행성 질병의 발병과 관련되어왔다 (Xu 외, 2010). 이것은 신경세포의 보존과 세포가 적절하게 기능을 수행하기 위한 세포 내 단백질 운반(intracellular trafficking)의 중요성을 나타낸다. 위의 실험 결과를 통해서, 식물세포에서도 간기동안에 CopⅠ 유전자가 silencing되면 Golgi의 defect에 의해 Golgi에서 ER로 retrograde trafficking의 기능에 문제가 생기고, 유사분열기에서도 골지체는 세포벽의 형성에 중요한 역할을 하기 때문에 동물세포와 같은 비슷한 기작이 있을 것이라고 유추해 보았다. 식물의 조직별 발현 패턴을 RNA gel blot (RT-PCR)을 이용하여 확인 해 본 결과 N. benthamiana CopⅠ subunit들은 조직 전반적으로 발현이 확인 되었다. 이들 subunit들과 상동성이 매우 높은 Arabidopsis thaliana (애기장대) ortholog의 각 promoter에 GUS를 fusion시켜 형질전환체 식물을 제조하여 각 유전자가 어떤 시기에 어떻게 발현이 되는지 확인 결과, 세포 분열이 왕성한 cell division 지역에서 주로 발현 하는 것을 확인하였다. 최근 동물 시스템에서 mitosis 단계의 전기에서 핵막 안쪽 (Inner nuclear membrane)에 존재하는 핵공단백질인 Nup153이 직접 CopⅠ을 핵 안쪽으로 유도하여 Nup153의 zinc finger domain과 CopⅠ이 결합한다는 중요한 사실이 알려지게 되었다 (Jin Liu외 2003). 또한, 핵막 안쪽뿐만 아니라 핵막 바깥쪽 (Outer nuclear membrane)에 존재하는 핵공단백질인 Nup358의 zinc finger domain과도 CopⅠ 유전자가 결합한다고 알려졌다 (Prunuske 외, 2006). 이것은 진핵세포의 mitosis 중 전기 (Prophase)에서 핵막붕괴가 이루어져야 그 다음 단계인 중기 (Metaphase), 후기 (Anaphase), 말기 (Telophase)를 거쳐, 세포질분열 과정까지 이르게 된다. 이러한 연구 결과들은 동물실험에서 CopⅠ 유전자의 mitotic 기능의 중요성을 강조하였다. 본 연구에서는 beta-prime, gamma, delta의 각 VIGS line으로 FACS를 통해 핵의 ploidy level을 분석한 결과, 높은 aneuploid level이 관찰되었다. 이러한 aneuploid는 동 ? 식물에서 세포사멸(lethality)을 유발하고, 질병(disease), 불임(sterility), 종양 형성(tumor formation)의 원인이 된다. 이는 CopⅠ subunit들이 silencing 되면, 식물에서도 mitotic phase에 어떠한 영향을 주기 때문에 염색체 분리 (Chromosome segregation)가 제대로 이루어지지 못해 염색체 수가 비정상적인 aneuploidy가 유도한다고 유추해 보았다. 이것은 BY-2 세포에서 NbBeta-prime의 Over-expression line을 제작하여 면역염색을 통한 mitotic localization 실험 결과, α-tubulin과 같은 곳에 존재 (co-localizaion)한다는 실험 결과와 NbBeta-prime의 Dexamethasone-inducible RNAi line 에서 후기 (Anaphse)가 지난 말기 (Telophase)에서도 여전히 anaphase bridge가 존재한다는 실험결과가 이를 뒷받침해주고 있다. 이로써 식물에서도 CopⅠ 유전자가 간기 (Interphase)에서 vesicle trafficking에 관련될 뿐만 아니라 mitotic 단계에서도 중요한 기능을 한다는 사실을 알게 되었다. 앞으로 CopⅠ 복합체가 결핍될 때 mitotic 단계에서 어떠한 원인으로 인해 anaphase bridge가 형성되는지 밝혀내는 것이 선결 과제이다.

Functional genomic analysis of pyrophosphate: fructose-6-phosphate 1-phosphotransferase gene family in Arabidopsis

임혜민 경희대학교 2011 국내박사

Pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP) catalyzes the reversible interconversion of Fru-6-P and Fru-1,6-P2, a key step in the regulation of the metabolic flux toward glycolysis or gluconeogenesis. In Arabidopsis, PFP genes were found to consist of four genes, PFPα1, PFPα2, PFPβ1 and PFPβ2, but there has been no genetic analysis to assess the biological functions of the entire gene family. The spatial expression patterns of the two AtPFPα genes were analyzed using transgenic plants containing a promoter::β-glucuronidase (GUS) fusion construct. Whereas the AtPFPα1 promoter was found to be ubiquitously active in all tissues, the AtPFPα2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPα2 promoter identified a key regulatory element from nucleotides &#8722;194 to &#8722;175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPα2 and which is essential for AtPFPα2 gene expression. To examine the role of PFP in plant growth, we have generated transgenic Arabidopsis plants that either overexpress or repress Arabidopsis PFP subunit genes. The RNAi lines showed significantly retarded growth in parallel with the reduced PFP activity. Analysis of photosynthetic activity revealed that the growth retardation phenotype of the RNAi lines was accompanied by the reduced rates of CO2 assimilation. Microarray analysis of our transgenic plants further revealed that the altered expression of AtPFPβ affects the expression of several genes involved in diverse physiological processes. The Arabidopsis pfp single, double and quadruple T-DNA insertion mutants were generated and analyzed. In particular, the pfpα1/pfpα2/pfpβ1/pfpβ2 quadruple mutant had greatly reduced levels of transcripts and PFP activity. The pfp double and quadruple mutants were growth retardation on limiting P media, and are significantly different from plant responses to osmotic and salt stress than wild type and double mutants. These results provide new information about roles of the Arabidopsis PFP in plant growth and responses to environmental stresses. Pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP)는 Fru-6-P와 Fru-1,6-P2의 가역적 상호전환반응을 촉매하여, glycolysis 또는 gluconeogenesis 방향으로의 물질대사 흐름을 조절하는 중요단계의 효소이다. 애기장대의 PFP 유전자는 PFPα1, PFPα2, PFPβ1, PFPβ2 등 4개로 구성되어있다. 그러나 아직까지 이들 유전자에 대한 생물학적 기능을 완전히 밝힌 유전적 분석에 대한 연구는 알려져 있지 않다. 두 개의 AtPFPα 유전자의 공간적 발현양상을 promoter::β-glucuronidase (GUS) fusion construct를 포함하는 형질전환 식물체를 이용하여 분석하였다. AtPFPα1 프로모터는 전체 조직에서 활성적인 반면, AtPFPα2 프로모터는 heterotrophic 조직인 잎의 trichome, 자엽맥, 뿌리, 꽃의 수술과 암술에 특이적으로 발현하였다. AtPFPα2 프로모터의 연속적인 결실 분석을 통하여 뉴클레오티드 &#8722;194에서 175까지(CGAAAAAGGTAAGGGTATAT)가 중요 조절 요소임을 확인하였다. 이 요소를 PFPα2라 명명하였고, AtPFPα2 유전자 발현에 필수적인 부분임을 밝혔다. 식물성장에 대한 PFP의 역할을 알아보기 위해, 애기장대 PFP 유전자의 과다발현과 억제발현 형질전환 식물체를 제작하였다. RNAi 형질전환 식물체는 PFP activity가 감소하는 것과 평행하게 심각한 성장지연을 보였다. 광합성률 분석에서는 CO2 동화의 감소하는 비율과 동일하게 RNAi 형질전환체의 성장저해 표현형을 나타내었다. 또한 microarray 분석결과 AtPFPβ의 변화된 발현은 식물의 다양한 생리학적 과정을 포함하여 여러 유전자의 발현에 영향을 주었다. 애기장대 PFP의 단일, 이중, 4중의 T-DNA 삽입 돌연변이체를 제작하고 분석하였다. pfpα1/pfpα2/pfpβ1/pfpβ2 4중 돌연변이체는 PFP activity와 transcripts level이 상당히 감소하였다. PFP의 단일, 4중의 돌연변이체는 limiting P 배지에서 약간의 성장저해를 보였다. 특히 삼투압, salt stress에 대해서 wild type과 이중 돌연변이체에 비해 현저한 표현형의 차이를 보였다. 이러한 결과들은 애기장대 PFP와 관련하여 식물성장과 여러 환경적인 스트레스에 대한 새로운 정보를 제공하였다.

무인증서 기반 인증 및 그룹키 합의에 관한 연구

임혜민 순천향대학교 대학원 2022 국내석사

IoT(Internet of Things)는 각종 사물에 센서와 통신 기능을 내장하여 무선 통신, RFID(Radio Frequency Identification), 분산 컴퓨팅 등의 기술을 통해 각종 사물을 연결하는 기술이다. IoT 기술은 우리 일상 속 곳곳에 스며들고 있으며 스마트 교통, 스마트 의료, 스마트 홈, 스마트 공장 및 스마트 팜 등의 분야에서 혁명적인 변화를 이끌고 있다. IoT 환경에서는 다양한 디바이스들의 역할과 위치에 따라서 그룹 형태를 연결해 통신하게 되며 그룹 통신 기술을 사용하여 효율적으로 일대다 혹은 다대다 통신이 가능하다. 하지만 이러한 서비스들은 공개된 네트워크를 통하여 제공하므로 메시지 위·변조, 사용자 프라이버시 침해 등 여러 보안 위협이 존재한다. 따라서, IoT 환경에서의 그룹 통신의 무결성 및 기밀성 등 안전성을 보장하기 위해 그룹 통신하기 전에 인증 및 그룹키 합의(Authentication and Group Key Agreement, AGKA) 방식을 구축해야 한다. 모든 그룹 구성원은 하나의 그룹키를 공유한 후, 이 그룹키를 사용하여 안전한 그룹 통신을 할 수 있다. 결론적으로, 효율적이고 안전한 AGKA 방식은 그룹 통신에서 중요한 역할을 한다. AGKA 방식에는 PKI(Public Key Infrastructure)를 포함해 ID-PKC (Identity-based Public Key Cryptography), 무인증서 기반의 AGKA(Certificateless- based AGKA, CL-AGKA) 방식들이 존재한다. 본 논문은 PKI와 ID-PKC에서 발생하는 인증서 오버헤드 문제와 키 에스크로 문제를 해결할 수 있는 CL-AGKA 방식에 대해 연구를 수행하였다. 세부적으로 제안방식 1은 그룹 구성원 간 통신 시 안정성과 효율성을 높이고자 정적 그룹 통신에서의 여러 보안 요구사항을 고려하였고, 이를 기반으로 위장 공격을 방지할 수 있는 One-Round CL-AGKA 방식을 제안하였다. 제안방식 2는 동적 그룹 통신환경에서 BV(Batch Verification) 방식을 이용하여 경량화된 CL-AGKA 방식을 제안하였다.