http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
염주옥 ( Ju Ok Yeom ),윤승배 ( Seung Bae Yoon ),김재경 ( Jae Gyung Kim ),오정환 ( Jung Hwan Oh ),전은정 ( Eun Jung Jeon ),정정조 ( Jeong Jo Jeong ),최상욱 ( Sang Wook Choi ),이성 ( Seong Lee ) 대한소화기학회 2009 대한소화기학회지 Vol.53 No.6
Hepatocellular calcinoma (HCC) is the fifth most common cancer and the third leading cause of cancer-related deaths worldwide. It is important to diagnose HCC exactly before management is attempted. But, the clinical presentations and radiologic findings of liver abscess, HCC, and metastatic tumor to the liver may be quite similar, and procedures such as serum tumor marker assay, computerized tomography, and ultrasonography of the liver cannot make a specific diagnosis. We report a case of HCC successfully diagnosed by surgery which was misconceived as liver abscess and not improved by medical treatment. (Korean J Gastroenterol 2009;53:378-382)
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
성인형 여드름 환자의 사춘기 여드름 환자의 지질도 및 Propionibacterium acnes 수의 비교
박연준,최성우,박현정,김형옥,채경옥,고재숙 대한피부과학회 2000 대한피부과학회지 Vol.38 No.9
Background: Acne is principally a disorder of adolescence. However, a number of observational studies have documented a significant degree of acne in adult women. One study found a difference in women between late-onset acne and acne that persisted from adolescence. There were significant higher sebum excretion rates among women whose acne originated during the teenage years compared with late-onset acne groups. Objective: The purpose of this study was to examine the clinical features of patients with acne and to compare the sebum excretion rates and the density of P acnes in adult acne with that in adolescent acne. Methods: Thirty nine patients with acne vulgaris were clinically evaluated. Sebum secretion rates were evaluated by Sebutape method. The density of P acnes counted by scrub method. Results: 1. The severity grades were mild to moderate in adult acne groups, consisting with the lower acne lesion counts than that of adolescent acne groups. 2. Sebum secretion rates by Sebutape method showed different patterns in two groups. The mean value in the adult acne groups was lower than that in adolescent acne groups, but not statistically significant. Chin area dominant pattern, shown in adult acne groups, were not apparent in adolescent acne groups. 3. The density of P acnes was a lower mean value in the adult acne groups, but not statistically significant. Only in adolescent acne groups, the severity grades are well correlated to the density of P acnes. Conclusion: Adult acne was mild to moderate in severity. Clinically, adult acne differs from adolescent acne in that the lesions are located most commonly around the chin. Sebum excretion rate was the highest in the chin area of patients with adult acne. But there was no significant difference in two groups. Also the density of P acnes was not signiticantly different in two groups.