http://chineseinput.net/에서 pinyin(병음)방식으로 중국어를 변환할 수 있습니다.
변환된 중국어를 복사하여 사용하시면 됩니다.
김향진,임재윤 濟州大學校 産業技術硏究所 1999 산업기술연구소논문집 Vol.10 No.1
This paper proposes the LSF or LSP that is the method .of using to transfer the speech parameters after processed the speech to LPC. which is digital coding transferring efficiently, for the best quality and the lowest bit rate of parameters. The new revised transform algorithms between LSF and LPC coefficients are proposed. The proposed algorithms eliminates all multiplications, computes fewer operations, and reduces memory buffer sizes.
Infrared radiation accelerates the dissolution rate of a microneedle array patch
( Jae Woo Lim ),( Shingyoung Song ),( Seha Park ),( Seulki Lee ),( Jinok Baek ),( Joo Young Roh ),( Hyang Joon Park ),( Jee-hyun Park ),( Cheong Bi Kim ),( Hyun-ji Lee ),( Jae Myun Lee ),( Jung-hwan P 대한피부과학회 2020 대한피부과학회 학술발표대회집 Vol.72 No.1
Background: The microneedle array patch (MAP) has been used for various applications because it is highly efficacious in delivering the active drug ingredient into the skin. Objectives: This study was performed to evaluate changes in transepidermal water loss (TEWL), the surface temperature of the skin, the dissolution rate of the MAP tips with infrared (IR) irradiation, and time for recovery from erythema that occurred after MAP attachment and IR irradiation. Methods: In this study, the dissolution rate of a MAP was increased, not by changing the drug formulation but by employing an IR device. TEWL increased more than fourfold IR irradiation. Water that evaporated as a result of IR irradiation was trapped in the skin layer by the patch, resulting in the increased dissolution rate of the MAP tips. Results: After 10min of IR irradiation, the height of the dissolving tips increased from 41 to 56%, and the dissolved volume of the tips increased from 7 to 18%. During the 10 min of irradiation, the skin surface temperature rose from 32 to 40°C. Erythema occurred in the early stage of treatment, but it abated within 2 h after removal of the MAP and cessation of IR irradiation. Conclusion: Through this study, it was possible to shorten the administration time of MAPs by using an IR device that could be easily accessed. This method can be applied to various types of MAPs to reduce the time that the MAPs must remain attached to the skin without changing the drug formulation.
Jae Hyang Lim,Chang-Hoon Woo 대한해부학회 2011 Anatomy & Cell Biology Vol.44 No.4
Atherosclerosis is readily observed in areas where disturbed flow is formed while the atheroprotective region is found in areas with steady laminar flow (L-flow). It has been established that L-flow protects endothelial cells against endothelial dysfunction including apoptosis and inflammation. It has also been reported that extracellular signal-regulated kinase 5 (ERK5) regulated endothelial integrity and protected endothelial cells from vascular dysfunction and disease under L-flow. However the molecular mechanism by which L-flow-induced ERK5 activation inhibits endothelial apoptosis has not yet been determined. Transcription factor p53 is a major pro-apoptotic factor which contributes to apoptosis in various cell types. In this study we found that 15-deoxy-Δ(12 14)-prostaglandin J2 induced p53 expression and that endothelial apoptosis was reduced under the L-fl ow condition. Th is anti-apoptotic response was reversed by the biochemical inhibition of ERK5 activation. It was also found that activation of ERK5 protected endothelial apoptosis in a C terminus of Hsc70-interacting protein (CHIP) ubiquitin ligasedependent manner. Moreover molecular interaction between ERK5-CHIP and p53 ubiquitination were addressed with a CHIP ubiquitin ligase activity assay. Taken together our data suggest that the ERK5-CHIP signal module elicited by L-flow plays an important role in the anti-apoptotic mechanism in endothelial cells.
Factors Associated with Removal of Impactted Fishbone in Children, Suspected Ingestion
Lim, Chun Woo,Park, Min Hwan,Do, Hyun Jeong,Yeom, Jung-Sook,Park, Ji Sook,Park, Eun Sil,Seo, Ji Hyun,Park, Jung Je,Lim, Jae Young,Park, Chan Hoo,Woo, Hyang-Ok,Youn, Hee-Shang The Korean Society of Pediatric Gastroenterology 2016 Pediatric gastroenterology, hepatology & nutrition Vol.19 No.3
Purpose: The management and clinical course in pediatric patients who had ingested foreign body were investigated retrospectively to evaluate the frequency and factor associated with successful removal of fishbone foreign body. Methods: Based on the medical records of patients younger than 15 years old who visited emergency room because of foreign body ingestion from January 1999 to December 2012, the authors reviewed clinical characteristics including type of ingested foreign bodies, time to visits, managements and complications. Results: Fishbone (50.1%) was the most common ingested foreign body in children. Among 416 patients with ingested fishbone, 245 (58.9%) were identified and removed using laryngoscope, rigid or flexible endoscope from pharynx or upper esophagus by otolaryngologists and pediatric gastroenterologists. The kind of ingested fish bone in children was diverse. The mean age of identified and removed fishbone group was 7.39 years old, and higher than that of unidentified fishbone group (5.81 years old, p<0.001). Identified and removed fishbone group had shorter time until hospital visit than the unidentified fishbone group (2.03 vs. 6.47 hours, p<0.001). No complication due to ingested fishbone or procedure occurred. Conclusion: Older age and shorter time from accident to hospital visit were the different factors between success and failure on removal of ingested fish bone in children.
영아에서 Helicobacter pylori 감염에 대한 항체반응
임재영,고경혁,조명제,김은아,김윤옥,윤희상,백승철,이우곤,이광호,우향옥,박찬후,정양숙 대한소화기학회 2000 대한소화기학회지 Vol.35 No.6
Background/Aims: The early stage of Helicobacter pylori (H. pylori) infection may show only anti-H. pylori IgM antibody response in young infants. We tried to find out the antigens of H. pylori which stimulate antibody response during the early stage of infection using IgM, IgA, and IgG immunoblot analyses. Methods: Sera of 48 infants were collected at birth and 7 months of age under the permission of parents and sera of 17 infants were also collected at 3 months and 9 months after birth. For those sera, IgM, IgA, and IgG immunoblotting were performed. Results: At the first study, seventeen of 48 (35.4%) infants show 120 kDa band on IgM or IgA immunoblot at 7 months of age. Four infants showed 120 kDa band on IgM immunoblot but not on IgA immunoblot. They were assumed to be infected very recently. At the second study, 2 of 17 showed strong IgM immune response to H. pylori at 3 months of age. The 120, 61, 60, 56, 54, 35, 29, 25, 18 kDa bands were recognized on IgM immunoblot in both studies. Conclusions: At 7 months of age, 35.4 % of infants were infected with H. pylori. Antigens of H. pylori which stimulate antibody response during the early stage of human infection were 120, 61, 60, 56, 54, 47, 29, 25, 18 kDa.
소아 위생검 조직절편을 이용한 H . pylori 감염 진단에 있어서 PCR 적용의 한계
임재영,고경혁,조명제,김윤옥,오영균,박철근,백승철,이우곤,이광호,우향옥,최명범,조윤경,정양숙,박찬후,윤희상,맹국영 대한소화기학회 1998 대한소화기학회지 Vol.31 No.1
Background/Aims: We tried to evaluate the clinical usefulness of the PCR for the diagnosis of H. pylori infection in children and to identify the possible false positive results by the PCR due to remaining H. pylori in the working channel of an endoscope or in the biopsy forceps. Methods: Forty seven urease test samples with three gastric biopsy specimens, 6 collections of 15 ml flushing distilled water after the end of working channel disinfection, 11 15 ml-distilled-water batches as the negative controls, and one H. pylori positive paraffin block as the positive control were collected at the Gyeongsang National University Hospital. The Hel-2 primer set (GTGTGCGGGCTTACAAGGAT, CGTTAGCGTTCATCACACTC) and a 34 cycle amplification were used Results: All of the seventeen specimens of urease tested positive within 6 hours and the ten specimens of urease also tested positive within 48 hours were PCR positive. Eighteen of the 20 specimens of urease tested negative and were also PCR positive. Three of the 6 specimens of 15 ml flushing distilled water were found to be PCR positive. All the negative controls were PCR negative and the one positive control was PCR positive. Conclusions: The clinical usefulness of PCR using gastric biopsy specimens in children was limited due to the possible dead or live H. pylori remaining in the biopsy channel.
Fringe-Field Switching Transflective Liquid Crystal Displays
Lim, Young-Jin,Choi, Min-Oh,Lee, Seung-Hee,Song, Jae-Hoon,Jeong, Youn-Hak,Kim, Hyang-Yul,Kim, Seo-Yoon,Lim, Young-Jin The Korean Infomation Display Society 2005 Journal of information display Vol.6 No.2
This paper investgates the transflective liquid crystal displays (LCDs) associated with fringe-field switching (FFS) mode to achieve high image quality. In the past, several cell structures were used to fabricate transflective FFS LCDs. Their structures and characteristics are carefully examined to find their merits and demerits. In addition, we attempt to optimize cell parameters to achieve a single driving circuit.