Research of Structural Risks of Object-Oriented Software Based on Ripple Degree of Software Network

Shujuan Cui,Sheng Bin,Gengxin Sun 보안공학연구지원센터 2016 International Journal of Multimedia and Ubiquitous Vol.11 No.1

Object-oriented software systems emerge from mere keystrokes to form intricate functional networks connecting many collaborating objects. In this paper, building on complex networks, software collaboration networks contained within several open-source software systems have been examined. Because of the association between objects, the ripple effect exists in those software networks. The distributions of forward and reversal ripple degree in software networks are analyzed, and focusing on high ripple degree nodes, a metric formula that evaluates the significance is presented. According to our metric, the fragile nodes, rigid nodes and a “hidden danger” node in software system can be selected, which can be used to provide guidance for design and remodeling of software systems.

A Robust Optimization Method Utilizing the Variance Decomposition Method for Electromagnetic Devices

Shujuan Wang,Qiuyang Li,Jinbao Chen 한국자기학회 2014 Journal of Magnetics Vol.19 No.4

Uncertainties in loads, materials and manufacturing quality must be considered during electromagnetic devices design. This paper presents an effective methodology for robust optimization design based on the variance decomposition in order to keep higher accuracy of the robustness prediction. Sobol’ theory is employed to estimate the response variance under some specific tolerance in design variables. Then, an optimal design is obtained by adding a criterion of response variance upon typical optimization problems as a constraint of the optimization. The main contribution of this paper is that the proposed method applies the variance decomposition to obtain a more accurate variance of the response, as well save the computational cost. The performance and robustness of the proposed algorithms are investigated through a numerical experiment with both an analytic function and the TEAM 22 problem.

Rate-based Modeling and Tec hno-Economic Analysis of a Pilot-Scale SMR Purge Gas Carbon Capture Process in a Chinese Refinery Plant

Shujuan Wang,Guojie Qi,Yongkang Cui,Lizhen Xu 한국에너지기후변화학회 2023 한국에너지기후변화학회 학술대회 Vol.2023 No.5

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

Shujuan Cui,Lili Tian,Xiaomin Peng,Guilan Lu,Weixian Shi,Dongmei Meng,Quanyi Wang 대한진단검사의학회 2012 Annals of Laboratory Medicine Vol.32 No.6

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...

Life cycle emissions of greenhouse gas for ammonia scrubbing technology

Shujuan Wang,Fang Liu,Changhe Chen,Xuchang Xu 한국화학공학회 2007 Korean Journal of Chemical Engineering Vol.24 No.3

is thought that the CO2 emissions from coal-fired power plants contribute greatly to the total anthropo-genic CO2 emissions. Ammonia solvent can be used to absorb the CO2, caled amonia scrubbing. However, as hasbeen pointed out, the production of ammonia would emit CO2; therefore, the efectiveness of amonia scrubbing isdoubted. The paper focuses on the problem. Two systems are defined in the paper. System I is CO2 absorption by am-2 emissions of the twosystems are calculated by means of life cycle asessment. The paper shows that the total CO2 emissions of ammoniascrubbing are less than that of the industrial production of fertilizer ammonium bicarbonate. It can be concluded thatammonia scrubbing is an effective way to reduce the anthropogenic CO2 emissions.

Complete genome sequence of Lactiplantibacillus plantarum ST, a potential probiotic strain with antibacterial properties

( Shujuan Yang ),( Chenglin Deng ),( Yao Li ),( Weicheng Li ),( Qiong Wu ),( Zhihong Sun ),( Zhenhui Cao ),( Qiuye Lin ) 한국축산학회 2022 한국축산학회지 Vol.64 No.1

Lactiplantibacillus plantarum (L. plantarum) ST was isolated from De’ang pickled tea in Yunnan Province, China. The genomes of strain ST were fully sequenced and analyzed using the PacBio RS II sequencing system. Our previous study has shown that L. plantarum ST is a potential probiotic strain. It had strong tolerance in the simulated artificial gastrointestinal tract, and in the antagonism tests, this strain showed strong antibacterial activity. Therefore, as a probiotic, it may be used in animal breeding. L. plantarum ST genome was composed of 1 circular chromosome and 7 plasmids. The length of the whole genome was 3320817 bp, and the annular chromosome size was 3058984 bp, guanine + cytosine (G ± C) content (%) was 44.76%, which contained 2945 protein-coding sequences (CDS). This study will contribute to a further comprehensive understanding of L. Plantarum ST at the genomic level and provide a theoretical basis for its future application in animal breeding.

An Economic Elucidation of the Antidumping Issue

Zhang Shujuan,ang Xiaotian 조선대학교 지식경영연구원 2005 지역개발연구 Vol.10 No.1

The paper constructs simple models to analyze the players' actions and motivations in the antidumping issue. On the basis of it the study goes deep into the characteristics of foreign antidumping against China and their causes and draws some important conclusions. Not only is there defects in the conventional definition of dumping but also the definition of dumping in Antidumping Agreement of WTO is necessary to be improved. We must tune up the drawback policy of exported goods lest it should become the backing exporters' malign competition and the excuse of foreign antidumping. The same antidumping tax on our exporters enormously cools down their enthusiasm. The main cause of the characteristics of foreign antidumping against China lies in Foreign Discrimination against China, especially Non-Market Economy Country.

Alternative Multiplicative Iterative Method for Projection Matrix Design in Compressive Images

Tian Shujuan,Fan Xiaoping,Xie Jingxiong,Li Zhetao,Choi Youngjune,Sekiya Hiroo 보안공학연구지원센터 2016 International Journal of Signal Processing, Image Vol.9 No.9

Five new species of Stenothemus Bourgeois from Guangxi, China (Coleoptera, Cantharidae)

Ge Shujuan,Liu Haoyu,Yang Xing-ke,Yang Yuxia 한국응용곤충학회 2021 Journal of Asia-Pacific Entomology Vol.24 No.3

Five new species of Stenothemus Bourgeois, 1907 from Guangxi, China are described, S. normalis sp. nov., S. flavicans sp. nov., S. nigripennis sp. nov., S. elongaticeps sp. nov. and S. maculaticollis sp. nov.. They are illus trated with habitus photos and aedeagi of males, also abdominal sternites VIII and internal genitalia of females. A key for the identification of the above species is provided.

중국인 학습자를 위한 한국어 착탈 동사 교육 연구

여숙연(Lu Shujuan) 학습자중심교과교육학회 2018 학습자중심교과교육연구 Vol.18 No.22

본 연구는 중국인 학습자를 대상으로 효과적인 착탈 동사 교육 방안을 모색하는데 목적을 둔다. 2장에서 한중 착탈 동사 유형 및 분류를 살펴보고 의미 대조를 하였다. 한중 착탈 동사는 서로 다대일, 일대다, 그리고 일대일의 대응 관계가 있다. 3장 에서는 중국인 학습자 30명을 대상으로 설문 조사를 하였다. 설문지는 중국어를 한국어로 번역 하는 번역 텍스트 총 20개로 구성된다. 4장에서 먼저 중국에서 많이 사용하고 있는 한국어교재<표준한국어>와<한국어>를 분석하여 교재에서 착탈 동 사가 어떻게 제시되어 있는지를 살펴보고 문제점과 보완점을 제시하였다. 그 다음으로 앞의 오류 분석과 교재 분석의 결과를 바탕으로 중국인 학습자에게 효과적인 한국어 착탈 동사 교육 방안을 모색하였다. Many Chinese learners find it very difficult to use the Korean wearing-taking off verb. The purpose of this study is to find out effective method of teaching Korean wearing-taking off verb for Chinese learners. In the second chapter we compare the Korean and Chinese wearing-taking off verbs. In the third chapter, a questionnaire survey was conducted on 30 Chinese people. Just as there are many types of wearing-taking off verbs in Korean, there are many types of Chinese wearing-taking off Verbs errors. In the fourth chapter, I analyzed the two most widely used textbooks in China. I found that these two textbooks are in shortcomings in the education of wearing off-words. I explored a teaching method based on the results of the previous error analysis and textbook analysis. This paper is on a teaching method of Korean wearing-taking off verbs for Chinese students. I regret that I have not yet identified the effect of the teaching method. I hope that through this paper, I can help a little bit in the future of Korean wearing-taking off verbs education for Chinese learners.